ID: 1063636437

View in Genome Browser
Species Human (GRCh38)
Location 10:7787617-7787639
Sequence CAGGCTGCCCGCTGGGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063636437 Original CRISPR CAGGCTGCCCGCTGGGCCCG GGG Intronic
900123530 1:1059513-1059535 CCGGCTGCCCGCGGGACCCCCGG + Intergenic
900140200 1:1136658-1136680 CAGGCGGCCCGCAGGGACCCAGG - Intergenic
900215685 1:1480347-1480369 CAGACTGCCAGCTGGGCGCCCGG - Intronic
900344127 1:2203115-2203137 TGGGCTGCCCTCTGGCCCCGGGG - Intronic
900376474 1:2357102-2357124 CAGGCTGGCCACTGGCCTCGAGG + Intronic
900480451 1:2895669-2895691 GCGGCTGCCCGCAGGGCACGAGG + Intergenic
900623544 1:3598136-3598158 CAGGCTGTTGGCTGGGCCCCTGG - Intronic
900780614 1:4615165-4615187 CAGACTGCTGGCAGGGCCCGAGG + Intergenic
900948637 1:5845167-5845189 CCGGCTGCCCGCTGGGAACACGG - Intergenic
901634029 1:10661327-10661349 CAGGCTTCCTGGTGTGCCCGGGG - Intronic
901749533 1:11397375-11397397 GATGCTGCCCGCTGGGTCCAGGG - Intergenic
901786736 1:11629773-11629795 CAAGCTGCCCCCTGGGACCCTGG + Intergenic
901921861 1:12542379-12542401 CAGGCTGTCTTCTGGGCCTGGGG - Intergenic
902410249 1:16207908-16207930 CTGGCTGCCCTCAGGGCCCATGG + Intronic
902477716 1:16697036-16697058 AGAGCTGCCCGCTGGCCCCGAGG - Intergenic
903182342 1:21611351-21611373 CAGGCTCAGCGCTGGGCCCTGGG - Intronic
904187111 1:28714189-28714211 GAGGCTGGCCGCTGGAGCCGGGG - Exonic
904431500 1:30467409-30467431 CAGGCTGCTCCCTGGGCATGGGG + Intergenic
905395196 1:37662305-37662327 CTGGCTGCCCACTGGGCACCTGG - Intergenic
906129583 1:43448163-43448185 CAGACTGCCCCCTGAGCCAGAGG + Exonic
906250701 1:44308725-44308747 CAGCCTGTCTGCTGGGCCAGGGG - Intronic
906254130 1:44334344-44334366 CAGGCTGCTCTCTGGGCCTCAGG + Intronic
906536105 1:46551798-46551820 CTGACTGCCCGCTGGGCCCTGGG - Intergenic
908825364 1:68127877-68127899 CAAGCAGCCTGCTGGGCCAGTGG - Intronic
912695194 1:111836306-111836328 CAAGCTGCCCGCAGGGACTGTGG - Intronic
916678801 1:167086230-167086252 CTGGCTCCCCGCTGGGGCCTGGG - Intronic
917788854 1:178486909-178486931 CTGGAGGGCCGCTGGGCCCGCGG + Intergenic
917931988 1:179828930-179828952 CAGGTTTCCAGCTGGGCCTGAGG - Intergenic
919326647 1:196115834-196115856 CAGGCTATCAGCTGGGCCCACGG + Intergenic
920926865 1:210349589-210349611 CAGCCTCCCAGCTGTGCCCGTGG - Intronic
921709880 1:218363358-218363380 CAAGCTGCCCACTGAGCCAGAGG - Exonic
922729673 1:227943000-227943022 CAGGCAGCCAGCTGTGCCCCAGG + Intronic
923517458 1:234709635-234709657 CGGGGTGACCGCTGTGCCCGGGG + Intergenic
924813166 1:247420994-247421016 GAGGCTGCCCTCTGGGCCATAGG - Intronic
1063636437 10:7787617-7787639 CAGGCTGCCCGCTGGGCCCGGGG + Intronic
1067291628 10:44947811-44947833 CAGGCTAGCAGCTGAGCCCGGGG - Intergenic
1070327626 10:75398938-75398960 AGGGCTGCCCGGTGCGCCCGAGG + Exonic
1070598477 10:77849326-77849348 CTTGCTCCCCGCTGGGCCCAAGG - Intronic
1070760534 10:79021542-79021564 CAGGCTGCTCCCTTGGCACGGGG + Intergenic
1070787823 10:79172254-79172276 GAGGCTCCCAGCTGGGCCCTAGG - Intronic
1071530872 10:86389709-86389731 CCGGCTGACCGCAGGGCTCGGGG + Intergenic
1073353351 10:102835223-102835245 CAGGCTGGCCCCTGGGGCTGGGG - Intronic
1075504275 10:123008663-123008685 CAGGCTGCCGGCTCGGACGGCGG - Intronic
1075564583 10:123494245-123494267 CAGGCTCCATGCTGGGCTCGGGG + Intergenic
1075647196 10:124104416-124104438 CCTGCTGCCCGCTGGCCCTGAGG - Intergenic
1075675900 10:124295635-124295657 CAGGCAGCCTGCTCTGCCCGCGG - Intergenic
1076379565 10:130015778-130015800 CAGCCTGCCCGCCTGGCCCCAGG - Intergenic
1076402998 10:130195484-130195506 CAGGTGGCCGGCTGGACCCGAGG + Intergenic
1076458465 10:130621635-130621657 GAGGCTTCCCGCTGTGCCTGTGG + Intergenic
1076740069 10:132478525-132478547 CCCTCTGCCCTCTGGGCCCGGGG + Intergenic
1076890791 10:133282252-133282274 GGGGCTGCCCGCAGGGGCCGAGG - Exonic
1077063149 11:626481-626503 CTGGCTGCCCCCTGGGCCTATGG - Exonic
1077144566 11:1038936-1038958 GGGGCTGCCCACTGGGCCTGTGG + Intergenic
1077147962 11:1054245-1054267 CAGGCTGCCCTCTGGCCCGGGGG - Intergenic
1077169693 11:1160676-1160698 CAGACTCACCGCTGGGCCCCCGG - Exonic
1077298169 11:1835639-1835661 GGGGCTGCCCCATGGGCCCGAGG + Intronic
1077497377 11:2892674-2892696 CGGGCTGCCGGCCGGGCCTGCGG - Intronic
1078057610 11:8019870-8019892 CAGGCTGCCATCTCGCCCCGCGG - Intronic
1078186153 11:9053583-9053605 CAGGCTGGCCACTGGCCCAGAGG - Intronic
1078801202 11:14644839-14644861 CTGGCTGCCTGCTGGCCCTGGGG + Exonic
1081669436 11:44934865-44934887 CTAGTTGCCCGCTGGGCCTGGGG - Exonic
1081805464 11:45887589-45887611 AAAGCTGCCCACTGGGCCAGAGG - Intronic
1082050579 11:47767343-47767365 GAGGCTGGGCGCTGGGCCCTGGG + Intronic
1084019782 11:66410578-66410600 CAGGCTGTCCTCTGGGGCCCAGG - Intergenic
1084518800 11:69650530-69650552 CAGGCTGATGGCTGGCCCCGGGG + Intronic
1084692975 11:70737647-70737669 CTGGCTGCCCACTGGGGCCTGGG - Intronic
1084915852 11:72428511-72428533 CTGGCTGGCTGCTGGGCCTGCGG - Intronic
1085508039 11:77071256-77071278 CAGGCTGCACACTGGGGCCAGGG - Intronic
1086951119 11:92890923-92890945 CACGCTGTCTGCTGGGCCTGTGG - Exonic
1087977291 11:104565274-104565296 CAGGCTGCACGCGGTGCTCGCGG - Intergenic
1088465263 11:110128420-110128442 CAGGCTTCCTGCTGAGCCCTGGG + Intronic
1088604208 11:111512790-111512812 CGGGGGTCCCGCTGGGCCCGGGG + Intergenic
1088836192 11:113579619-113579641 GAGGCTGCACACAGGGCCCGGGG + Intergenic
1091237800 11:134033425-134033447 CAGGCTCCCCACTGTGCCTGGGG + Intergenic
1091567130 12:1657136-1657158 CAGGCTGCTGGCTGTGCCCTAGG + Intergenic
1092264498 12:6970492-6970514 ACGGCTGCCCGCCGGGCCCCGGG - Exonic
1092953243 12:13526894-13526916 CAGGCTGCCCACTGATCCTGTGG - Intergenic
1095948147 12:47765558-47765580 GAGGGTGCCTGCTGGGCCCTGGG + Intronic
1096677078 12:53231837-53231859 CAGGCTGGCCGCCGGGCTTGAGG - Intronic
1101131662 12:101697317-101697339 CACGCTGCCCGCAGAGCCTGGGG - Intronic
1102219633 12:111185836-111185858 CAGGCAGCCCCCTCGGACCGTGG - Intronic
1102220882 12:111193693-111193715 GGGGCTGCCGGCTGGGCCTGGGG + Intronic
1103008123 12:117438118-117438140 CAGGCTGGTGGCTGGACCCGAGG - Intronic
1103614058 12:122141176-122141198 CAGGCAGCCAGGTGGGGCCGGGG + Intronic
1104906535 12:132216456-132216478 CTGGCTCCTCGCTGGGCCTGCGG - Intronic
1104948605 12:132428590-132428612 CAGGCAGGCCGCTGTGCCCCGGG - Intergenic
1104977405 12:132558280-132558302 CAGGCTGGCCGCAGGGCTCATGG - Intronic
1106108965 13:26760538-26760560 CAGGCGGCCCGCGGGGGCGGGGG + Intronic
1113424698 13:110198476-110198498 CAGGCTGCCCAGGGGGCCCAGGG + Exonic
1114651061 14:24284803-24284825 CAGGCAGGCGGCTGGGCCCAGGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115506819 14:34101069-34101091 CAGGCTGCTCGCTGGGCTCTGGG - Intronic
1115754566 14:36518881-36518903 CAGGCTGCGCGCTGGGCATCAGG - Intronic
1115852412 14:37598673-37598695 GAGGCCGCCGTCTGGGCCCGGGG - Intronic
1121313110 14:92945790-92945812 CCTGCTGCCAGCTGGGCCCTAGG - Intronic
1122295977 14:100705968-100705990 CAGGCTGTGCACTGGGCTCGGGG + Intergenic
1122718212 14:103707793-103707815 CAGGCTGCGCTCTTGGCCTGGGG + Intronic
1122745981 14:103897461-103897483 CAGGCTGGCCTCTGGCACCGAGG + Intergenic
1122768224 14:104085665-104085687 CAGGCTGCCCCCGGCGCCCCGGG + Exonic
1122784216 14:104156476-104156498 CTGGGTGCCCCCTGGGCCCTAGG - Intronic
1122887397 14:104716210-104716232 TATGCTGACCGCTGGGCCTGGGG + Intronic
1122929309 14:104926118-104926140 CAGGCTGGGCGCTGGGACCCAGG - Intronic
1122961837 14:105097477-105097499 CAAGCTGCCCTCTGGGCTCAGGG + Intergenic
1122968302 14:105142124-105142146 CTGGCTGCCGGCACGGCCCGTGG - Exonic
1123688870 15:22820681-22820703 GAGGCTCCCCGCAGGGCCTGAGG - Intronic
1123948438 15:25250128-25250150 CAAGCTGCCCCCTTGGCCCAAGG - Intergenic
1125554112 15:40569876-40569898 CAGGCGGCCCGCCCGGACCGCGG - Exonic
1125608048 15:40953309-40953331 CAGCGGGCGCGCTGGGCCCGCGG + Exonic
1126102855 15:45130028-45130050 CTGGCTGCCAGCTGGGCCCGCGG - Exonic
1128730093 15:70015087-70015109 CAGGTTGCAGGCTGGGCCCGTGG + Intergenic
1129221513 15:74134267-74134289 CTGGCTGCGCGCTGGGGCCCTGG + Exonic
1129541041 15:76347136-76347158 GGGGCCGCTCGCTGGGCCCGCGG + Intergenic
1131144595 15:90002542-90002564 CAGGCTACCAGGTGGGCGCGCGG + Intronic
1131259685 15:90882015-90882037 CAGGTGGCCAGGTGGGCCCGAGG - Exonic
1131828664 15:96340862-96340884 CAGCCTGCTCGCTCGGCTCGCGG + Intergenic
1132290933 15:100703511-100703533 CAGACTCCCCACTGGGCCCAAGG - Intergenic
1132854230 16:2037717-2037739 GAGGCTGCCTGCTGGGGCTGGGG - Intronic
1132872485 16:2122041-2122063 CAGGCTGCCCGGTGGGGCCCGGG + Intronic
1132897069 16:2234112-2234134 CAGGCGGCCTGGCGGGCCCGCGG + Intronic
1132933577 16:2470481-2470503 CTCCCTGCCAGCTGGGCCCGTGG + Intergenic
1134205598 16:12235354-12235376 GAGGCTGTCCCCTGGGCCTGCGG + Intronic
1134304721 16:13021834-13021856 CAGGCTGCCCCCTCAGCCCATGG - Intronic
1134551581 16:15141241-15141263 CAGGCTGCCTGGTGGGGCCCGGG + Intergenic
1138417042 16:56877658-56877680 CAGGCGGCCAGCTGGGCAGGGGG - Intronic
1138473716 16:57258384-57258406 CAGGCTGCTCGCTTGGTCTGAGG - Intronic
1138540364 16:57684053-57684075 GATGCTGCCTGCTGGGCCCGGGG + Exonic
1139447207 16:67005187-67005209 CTGGGTGCCAGCTGGGCCAGAGG - Intronic
1140456583 16:75109290-75109312 CCGGGAGCCCGCTGGGCACGGGG - Exonic
1140472849 16:75224852-75224874 CTGGCTGCCAACTGAGCCCGCGG + Exonic
1141203306 16:81913810-81913832 CAGGCTGCCCCCTGGGCGTTTGG + Intronic
1142119239 16:88377729-88377751 CAGGATGCCAGCTGGGACAGGGG - Intergenic
1142198169 16:88748375-88748397 CAGGCTGCAGGCTTGGCACGTGG + Intronic
1142613617 17:1122955-1122977 CAGGCTTCCTGCTGGGGCCTTGG - Intronic
1143120063 17:4600795-4600817 CAGGCTTCCCGCTTGCCCTGCGG + Intronic
1143139804 17:4735257-4735279 CAGTCTGGCAGCTGGGCCTGAGG - Exonic
1143402043 17:6652223-6652245 CGGGCGGCCGGCTTGGCCCGCGG - Exonic
1144789808 17:17851170-17851192 CAGGCTCCCGGCAGGGCCGGCGG + Intronic
1145760497 17:27422783-27422805 CCGGCTGCTCCCTGGGCCAGGGG - Intergenic
1148852353 17:50561265-50561287 CATGCTGCCCGCGGGGCGCCGGG - Intronic
1149849189 17:60025548-60025570 CTGGCTCCCCGCTTGTCCCGAGG + Intergenic
1149860979 17:60120976-60120998 CTGGCTCCCCGCTTGTCCCGAGG - Intergenic
1151486791 17:74406051-74406073 CAGGCCCCCAGCTGAGCCCGTGG - Intergenic
1151562076 17:74875807-74875829 CAGGCAGCCCTCTTGGCACGAGG - Intergenic
1152206447 17:78977021-78977043 CTGGCTAACCGCTGGGCCCCGGG + Intronic
1152250845 17:79211901-79211923 CAGGCTGACTGCTGGGCACGGGG + Intronic
1152297743 17:79478107-79478129 CAGGCTGCCCGCATGAGCCGTGG - Intronic
1152716791 17:81904121-81904143 CAGGCTGCCCGCTGCACTCCCGG + Intronic
1152783991 17:82238644-82238666 CGGGCTGCCCCCAGGGCCCACGG - Intronic
1153818229 18:8809501-8809523 CAGGCTGCCAGCTGGGTCCACGG + Intronic
1153820301 18:8826155-8826177 CAGGCTGCCCACGGGCCCCCGGG + Exonic
1155159178 18:23182006-23182028 CTGGCTGCACGCTGGGCCACTGG - Intronic
1160453553 18:78980499-78980521 CAGGCCGGCCGCGGGGCCCCGGG + Intronic
1160680001 19:408178-408200 CAAGCTGCCCTCGGGCCCCGCGG - Exonic
1161107953 19:2453890-2453912 GAGGCCGCCTGCTGGACCCGTGG - Intronic
1161202696 19:3024839-3024861 CAGGCATCCCGCTGGGGCAGGGG - Intronic
1161319974 19:3636624-3636646 CTGGCTTCCCGCTGGCTCCGTGG + Intronic
1161480503 19:4508017-4508039 CAGGGAGCCCGCAGGGCCTGGGG - Intronic
1162125657 19:8498415-8498437 CCCGCTGCCCCCGGGGCCCGTGG - Exonic
1162128276 19:8511016-8511038 CCGCCTGCCCGCAGGGCACGCGG - Exonic
1162367800 19:10259779-10259801 CGGGGTGGCCGCTGGGCCCTGGG - Exonic
1162433359 19:10642644-10642666 CAGGCTGCAGCCTGGGCCAGTGG - Intronic
1163638880 19:18450524-18450546 CAGTCTGGAAGCTGGGCCCGGGG + Exonic
1164208284 19:23075526-23075548 CAAGATGGCGGCTGGGCCCGCGG + Intronic
1164763265 19:30743946-30743968 CCGGCTGCCCCCAGGGCCAGTGG + Intergenic
1165417698 19:35704851-35704873 CAGGCTGGCCTCGGGGGCCGTGG - Intronic
1167158823 19:47754964-47754986 CAGGCTGCCCGCAGCACCCAGGG - Intronic
1168298308 19:55388687-55388709 CAGGCTGAGGGCTGGGCCCTGGG + Intronic
1202711732 1_KI270714v1_random:22862-22884 AGAGCTGCCCGCTGGCCCCGAGG - Intergenic
927692236 2:25216245-25216267 CTGGCGGCGCGCTGGGCCTGGGG - Intergenic
927810195 2:26176167-26176189 CGGGCTGCCAGCTGGGGCCTGGG - Intronic
927843696 2:26460776-26460798 CAGGCTGCGTGCTGGGCCCTTGG + Intronic
927940711 2:27101402-27101424 CAGCTTCCCCTCTGGGCCCGGGG + Exonic
927940730 2:27101453-27101475 CAGCTTCCCCTCTGGGCCCGGGG + Exonic
928078565 2:28287875-28287897 CAGGCTGCCTGCTGGAACTGAGG - Intronic
929640573 2:43574919-43574941 CAGGCTGTCCGTTAGGCTCGGGG + Exonic
934564087 2:95328900-95328922 CAGGCTGCTGGCTGGGGCCAGGG + Intronic
935682810 2:105652548-105652570 GAGGCTGCGTGCTGGGCCTGTGG + Intergenic
936093198 2:109513957-109513979 CAGGCAGCCTCCTGGGCCTGGGG + Intergenic
936112777 2:109678394-109678416 CTGGCTACCCACTGGGCCTGGGG + Intergenic
936452721 2:112645741-112645763 CCGGCTCCCCGCTGGGGGCGTGG + Intergenic
936572347 2:113627328-113627350 CAGACTGGCGGCAGGGCCCGAGG + Exonic
937904669 2:127047124-127047146 CAGGCTGCTCCCTGGGCCCATGG + Intergenic
944661905 2:201928573-201928595 CAGGGTGCAGGCTGGGCCAGGGG - Intergenic
946195058 2:218027878-218027900 CAGACTGCAGGCTGGGCCAGAGG + Intergenic
948202028 2:236136255-236136277 CAGGCTGGTCCCTGGGCCCTGGG - Intergenic
949049994 2:241892514-241892536 CAGACTGCCCGCTGCCCCTGTGG + Intergenic
1168965944 20:1898011-1898033 CAGGATGCCTGCTTGGCCCCAGG + Intronic
1170759867 20:19239831-19239853 AAGGCTGCCCACAGGGCCCCTGG - Intronic
1172584726 20:36074864-36074886 CAGGATGCCAGCTGGGCGCAGGG - Intergenic
1172983460 20:38962557-38962579 CAGGCTCCCCAGTGGTCCCGAGG + Intronic
1173495281 20:43514036-43514058 CAGGCCGCCCCCTGGGGGCGGGG - Exonic
1173613625 20:44388762-44388784 CAGGCACCGCGCTGGGCCGGAGG - Intronic
1173658431 20:44716737-44716759 CAGGCTGGCCGTTGGCTCCGGGG + Intronic
1174354134 20:49987225-49987247 CAGGCTGCTGGCCGGGCCCCAGG + Intronic
1174386037 20:50189278-50189300 CCGCCTGCCCGCTGGGGCCAGGG + Intergenic
1174448843 20:50608008-50608030 CTGGCTGCCCCCTTGGCCTGGGG - Intronic
1175517314 20:59577659-59577681 CGGGGTGCCCGCCGGGCACGAGG + Intronic
1175918325 20:62437998-62438020 CTGCCTGCCCGCTGAGCCCCGGG - Intergenic
1176122162 20:63458788-63458810 CAGGCTGGCAGCTAGGCCTGGGG + Intronic
1176258739 20:64167691-64167713 CAGGGTGCCCGCAGGGGCTGGGG + Intronic
1176550282 21:8217893-8217915 CCGGCGGCCCGCAGGGCCGGCGG - Intergenic
1176569210 21:8400931-8400953 CCGGCGGCCCGCAGGGCCGGCGG - Intergenic
1176577124 21:8445163-8445185 CCGGCGGCCCGCAGGGCCGGCGG - Intergenic
1178878396 21:36429881-36429903 CAGGCTGCCTGGAGGGGCCGAGG - Intergenic
1179173612 21:38991700-38991722 CAGGCTGCCCACTTGGCCTCTGG - Intergenic
1179678881 21:43003723-43003745 CAGGCAGCATGCTGGGCCTGGGG - Intronic
1180073269 21:45449286-45449308 CAGGCTGCCCGCTGAGCGCCAGG + Intronic
1180103136 21:45599250-45599272 CTGGCTGCACGCTGGGCCTCCGG + Intergenic
1180910715 22:19447968-19447990 CAGGATGCCCGCCTGGCCCGGGG - Exonic
1180986247 22:19905520-19905542 GAGGCTGCCCGCTTGGGCCTGGG - Intronic
1181172951 22:21020418-21020440 GAGCCTCCCCGCTGGGCCAGGGG + Intronic
1183085647 22:35485316-35485338 CAGGCCTCCCGTTGGGCCCAGGG - Intergenic
1183219962 22:36506299-36506321 CGTGCTGGGCGCTGGGCCCGCGG - Exonic
1183465918 22:37980365-37980387 CTGGCTGCCAGCTGGGCAGGGGG - Intronic
1183593269 22:38794038-38794060 CTGGCTGCCCGCCGCGCCCCGGG + Intronic
1183720316 22:39558360-39558382 CAGGCTGCCGGCCGGGGCCCGGG + Intergenic
1184090298 22:42289790-42289812 CAGGGTGGCAGCTGTGCCCGGGG - Intronic
1184198777 22:42950811-42950833 CAGGCACCTCGCTGGGCCTGTGG + Intronic
1184642748 22:45880972-45880994 AAGGCTGCCCGGGGGGCCGGGGG - Intergenic
1184676004 22:46043977-46043999 CTGGCTGCCAGCTGGGCCTGAGG - Intergenic
1184731538 22:46373602-46373624 CAGGCTCCCCTCTGGGTCCCGGG + Intronic
1185121756 22:48975479-48975501 CAGGCTGCCTGCATGGCCGGGGG - Intergenic
1185153279 22:49178607-49178629 CCAGCTCCCCGCTGGGCCCAGGG + Intergenic
1185317471 22:50185302-50185324 TAGGCTGGCCGCGGGGCCCCTGG + Intergenic
1185319573 22:50194268-50194290 CAGGCTGCCAGCGGGCCCGGCGG + Intronic
1185332548 22:50258207-50258229 TGGGCTGGCCGCTGGGCACGAGG - Intronic
1185427842 22:50783551-50783573 CAGACTGGCGGCAGGGCCCGAGG - Exonic
1203255177 22_KI270733v1_random:134231-134253 CCGGCGGCCCGCAGGGCCGGCGG - Intergenic
1203263233 22_KI270733v1_random:179310-179332 CCGGCGGCCCGCAGGGCCGGCGG - Intergenic
950702026 3:14757421-14757443 CAGACTGCCCGCTGGTGCTGCGG + Exonic
951508934 3:23480139-23480161 CAAGCTGCCCGCAGTGCCCCCGG + Intronic
952816728 3:37452922-37452944 CAGGAGGCTCGCTGGGCCAGCGG - Intronic
954437303 3:50503085-50503107 CCGGCTGCCCGCTGCGCCCGGGG - Intronic
954863936 3:53713065-53713087 CAGGCTGCTGGCTGGACCCCTGG + Intronic
955348671 3:58178879-58178901 GAGGCTGCCCACAGGGCCCTGGG - Intergenic
956912637 3:73835008-73835030 CAAGCTGGCCCCTGGGCCCCTGG - Intergenic
958638578 3:96777023-96777045 CGCGCTGCCTGCTGCGCCCGCGG - Intergenic
959505515 3:107152478-107152500 CAGGCTGCCCCCTGGGAAAGGGG - Intergenic
960586238 3:119323300-119323322 CTGGCTGCCCCCAGGGCCGGCGG - Intronic
961123024 3:124390057-124390079 CTGGCTGCCCTCTTGGCCCCAGG - Intronic
961573502 3:127816993-127817015 CAGGCTGCACCCTGGCCCCGAGG + Intronic
962222337 3:133574136-133574158 GGCGCTGCCCGCTGCGCCCGCGG - Exonic
963673535 3:148280857-148280879 CAGGCTGCACGCTGCGCTTGCGG - Intergenic
965040259 3:163499045-163499067 CAGGCTGCGCGCTGCGCCTGCGG + Intergenic
968505470 4:969179-969201 CAGGCTGTCCCCAGGACCCGGGG - Intronic
968586325 4:1418019-1418041 CAGGCTGCCCGCACGCCTCGCGG + Intergenic
968605267 4:1532382-1532404 CAGGCAGCCAGCTGGGCACAGGG + Intergenic
968674648 4:1871141-1871163 GAGGCGGCTCGCGGGGCCCGCGG + Intergenic
968724901 4:2242267-2242289 CAGGATGCCCGCAGCGGCCGGGG - Intergenic
968876076 4:3268666-3268688 CAGGCTGCCCTCCCGGCCTGTGG - Intronic
969052429 4:4382725-4382747 CAGCGTGCCGGCTGGTCCCGTGG + Intronic
973551256 4:52038156-52038178 CGTCCTGCCGGCTGGGCCCGCGG - Intronic
973858006 4:55032867-55032889 AAGGCTGCCCTCTGGACCCCAGG + Intergenic
973970916 4:56213033-56213055 CAGGCTACCTGCTAGGCCCATGG - Intronic
974876986 4:67713366-67713388 CAGGCTGCCTGCATGGCCCTAGG - Intergenic
977969578 4:103198221-103198243 CCCGGTGCCCGCTGGGCCTGCGG - Intronic
979624171 4:122827195-122827217 CACGCTGCCCGCCTTGCCCGAGG + Exonic
982081693 4:151796631-151796653 TAGGCTGCCCTCTGTGCCTGGGG - Intergenic
985381439 4:189399073-189399095 CAGGCTGCCCCCAGGGCCTCAGG - Intergenic
986029867 5:3883847-3883869 CAGGCTGCCTGCTCTGCCCCTGG - Intergenic
986775144 5:11007439-11007461 CAGGCTGCCAGCAGTTCCCGAGG - Intronic
988878253 5:35472058-35472080 CAGGCTGCCTGCTAGGCACTGGG + Intergenic
989126037 5:38053237-38053259 CAGGCAGCCCACAGGGCCTGAGG - Intergenic
990281014 5:54250726-54250748 CAGGCTGCCCCCAGGACCTGTGG - Intronic
994072337 5:95617147-95617169 CAGGATGACCGCTGGCCCAGAGG + Intergenic
994072339 5:95617155-95617177 CATGTTGCCCTCTGGGCCAGCGG - Intergenic
996581212 5:125034471-125034493 CAAGCTGCCTGCTGGGGCCGTGG - Intergenic
998157113 5:139793356-139793378 CAGGCAGCCCTCTGAGCCCTAGG + Intergenic
1000980697 5:167813637-167813659 CAGGCTGCTGACTGGGCCAGTGG - Intronic
1002523367 5:179803330-179803352 CAGGCTCCACGCTGGGCTCAGGG + Intronic
1003171878 6:3726593-3726615 CAGGCCGCCGGCTGGGGCCCAGG + Intronic
1003604250 6:7544361-7544383 CAGGGTGCCCTCTGTGCCCAAGG + Intronic
1006449400 6:34097514-34097536 GAGGCTGCTGGCTGGGCCTGGGG - Intronic
1007262341 6:40572563-40572585 CAGGCAGCCTGCTGGGCTGGTGG - Intronic
1012887173 6:104859525-104859547 CAGGCTGGCCGCGGGGCTGGGGG - Intronic
1015842982 6:137493252-137493274 GAGGCTGCACGCTCGGCCCACGG - Exonic
1016010882 6:139135929-139135951 CGGGCAGCAGGCTGGGCCCGAGG - Intronic
1018091264 6:160348352-160348374 GAGGCCGCCGGCTGGGTCCGCGG + Exonic
1018478631 6:164168176-164168198 GAGGCTGCCCGTTGGTCCCTCGG + Intergenic
1019474081 7:1235767-1235789 CGGGCTGGCCGCCGGGGCCGAGG - Intronic
1019481462 7:1268730-1268752 CCGGCTGCCGGCTGGGGACGCGG + Intergenic
1019759919 7:2803368-2803390 GAGGCTGCCTGCAGGTCCCGTGG + Intronic
1019968282 7:4519212-4519234 CAGGCTGGGTGCTGGGGCCGGGG - Intergenic
1022094485 7:27130344-27130366 CAGGCCGTGCGCTGGGCCCTTGG + Exonic
1022111528 7:27235405-27235427 CAGGCTGCCCTCTGGGGATGGGG + Intergenic
1022112342 7:27239459-27239481 CAGTCTGCCCGCCCGGCTCGGGG - Intergenic
1023955589 7:44884704-44884726 CAGGCCGCCCCCTGGGCCCCCGG + Exonic
1025716770 7:63964650-63964672 CAGGCAGCCAGCTAGGCCAGGGG - Intergenic
1026562857 7:71464693-71464715 CAGGCTCCCCACTTGGTCCGTGG + Intronic
1027774083 7:82443576-82443598 CTGGCTGCGCCCGGGGCCCGAGG + Exonic
1029459917 7:100688580-100688602 CAGGCTGCCAGGTGAGCCCCGGG - Exonic
1033570916 7:142627450-142627472 CAGGGGGCCCGCTGGGGCGGAGG - Intergenic
1034991616 7:155551143-155551165 CAGGCCCGCCGCTGTGCCCGTGG + Intergenic
1035536110 8:392592-392614 CAGGCTCCCGGCAGGGCCCTTGG - Intergenic
1035633974 8:1129581-1129603 CAGGCTTCCCGCAAGGCTCGTGG - Intergenic
1039050042 8:33484719-33484741 CTGGCTGCGAGCTGGGGCCGGGG + Intronic
1039544878 8:38402570-38402592 CAGGCTGCCTGTAGGGCCCGAGG + Exonic
1040817452 8:51523769-51523791 CAGGCTCACCCCTGGGCCTGAGG - Intronic
1042591500 8:70402785-70402807 CAGGAGGCGCGCTGGGGCCGGGG - Intronic
1043515737 8:80993207-80993229 CAGGCTCCCCGCGGGCCCCATGG + Exonic
1045114981 8:98972565-98972587 CTGGCTGCCCGCCCGGGCCGCGG - Intergenic
1047814732 8:128450840-128450862 CAGTCTTACCTCTGGGCCCGAGG + Intergenic
1048457733 8:134593088-134593110 CAGGATGCCCGCCTGACCCGGGG - Intronic
1049408678 8:142462879-142462901 GTGGATGCCCGCTGGGCCCAGGG + Intronic
1049566653 8:143343783-143343805 CGGGCTGCACGCTGGGTCAGAGG + Intronic
1049998376 9:1051715-1051737 CCGGCGGCGGGCTGGGCCCGGGG - Exonic
1052902206 9:33802923-33802945 CAGGCAGCCCGCTGTGGCCCTGG - Intergenic
1054340801 9:63859904-63859926 CAGGCTGCCCTCCTGGCCTGCGG + Intergenic
1055552043 9:77440349-77440371 GGGGCTGCCCGCTGGGCTCTGGG - Intronic
1057182850 9:93039183-93039205 CATGCTGTTCCCTGGGCCCGGGG + Intergenic
1060405381 9:123370454-123370476 CACACTGCCCGCTGGGACCTTGG + Exonic
1060410304 9:123395654-123395676 CAAGATGCCAGCTGGGCCCTCGG - Intronic
1060661747 9:125408664-125408686 CAGGCTGCGAGCTGTGCCCGTGG + Intergenic
1061128197 9:128689717-128689739 CAGGCCGCCGGCGGGGCCCGGGG + Intronic
1061203005 9:129148061-129148083 CACCCTGCCCCCTGGGCCTGAGG + Exonic
1061365109 9:130168583-130168605 CAGGCTGACCCCCGGGCCCCAGG + Intergenic
1061999911 9:134210740-134210762 CAGGCTGTCCGCTGTGACCATGG + Intergenic
1062162402 9:135087635-135087657 CGGGCTGCGCGCGGGGGCCGCGG - Intronic
1062266608 9:135689448-135689470 CCGGCTGCCAGCTGGGCCAGGGG + Intergenic
1062561080 9:137142180-137142202 CAGGCTGTGCCCTGGGGCCGAGG - Intronic
1062689772 9:137835156-137835178 CAGCCTGGGCACTGGGCCCGCGG - Exonic
1203471575 Un_GL000220v1:117368-117390 CCGGCGGCCCGCAGGGCCGGCGG - Intergenic
1203479396 Un_GL000220v1:161340-161362 CCGGCGGCCCGCAGGGCCGGCGG - Intergenic
1189114300 X:38327369-38327391 CAGGCTGCCCGTACTGCCCGTGG - Exonic
1192437657 X:71152949-71152971 GAGCCTGCCCACTGGGCCCCAGG + Intronic
1196812359 X:119638807-119638829 CAGGCAGCCTGCAGGGCCCTCGG - Intronic
1200115408 X:153767738-153767760 CTGGGTGCCCCTTGGGCCCGCGG - Exonic
1200759702 Y:7026616-7026638 CATGCTGCTTGCTGGTCCCGAGG + Intronic
1201073555 Y:10170673-10170695 CAGGCTGAGTGCTGGGCCCACGG - Intergenic