ID: 1063643895

View in Genome Browser
Species Human (GRCh38)
Location 10:7859381-7859403
Sequence CTGAGTTTCAGGAGGGCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063643886_1063643895 5 Left 1063643886 10:7859353-7859375 CCTGCCTTCAGATCCTGCCATGT 0: 1
1: 0
2: 2
3: 24
4: 241
Right 1063643895 10:7859381-7859403 CTGAGTTTCAGGAGGGCAGCGGG No data
1063643889_1063643895 -8 Left 1063643889 10:7859366-7859388 CCTGCCATGTGGATTCTGAGTTT 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1063643895 10:7859381-7859403 CTGAGTTTCAGGAGGGCAGCGGG No data
1063643885_1063643895 25 Left 1063643885 10:7859333-7859355 CCTCTTCTACATATACACATCCT 0: 1
1: 0
2: 4
3: 33
4: 301
Right 1063643895 10:7859381-7859403 CTGAGTTTCAGGAGGGCAGCGGG No data
1063643888_1063643895 1 Left 1063643888 10:7859357-7859379 CCTTCAGATCCTGCCATGTGGAT 0: 1
1: 0
2: 1
3: 13
4: 195
Right 1063643895 10:7859381-7859403 CTGAGTTTCAGGAGGGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063643895 Original CRISPR CTGAGTTTCAGGAGGGCAGC GGG Intronic
No off target data available for this crispr