ID: 1063652457

View in Genome Browser
Species Human (GRCh38)
Location 10:7951589-7951611
Sequence GAGGTGGACATGATTTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 1, 1: 0, 2: 5, 3: 83, 4: 562}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063652457_1063652463 11 Left 1063652457 10:7951589-7951611 CCACCCAAAATCATGTCCACCTC 0: 1
1: 0
2: 5
3: 83
4: 562
Right 1063652463 10:7951623-7951645 AGCTGTAGAAGCCCAGTGGAAGG No data
1063652457_1063652469 28 Left 1063652457 10:7951589-7951611 CCACCCAAAATCATGTCCACCTC 0: 1
1: 0
2: 5
3: 83
4: 562
Right 1063652469 10:7951640-7951662 GGAAGGGCATAGATGCAGGGAGG No data
1063652457_1063652464 12 Left 1063652457 10:7951589-7951611 CCACCCAAAATCATGTCCACCTC 0: 1
1: 0
2: 5
3: 83
4: 562
Right 1063652464 10:7951624-7951646 GCTGTAGAAGCCCAGTGGAAGGG No data
1063652457_1063652462 7 Left 1063652457 10:7951589-7951611 CCACCCAAAATCATGTCCACCTC 0: 1
1: 0
2: 5
3: 83
4: 562
Right 1063652462 10:7951619-7951641 GAACAGCTGTAGAAGCCCAGTGG No data
1063652457_1063652467 24 Left 1063652457 10:7951589-7951611 CCACCCAAAATCATGTCCACCTC 0: 1
1: 0
2: 5
3: 83
4: 562
Right 1063652467 10:7951636-7951658 CAGTGGAAGGGCATAGATGCAGG No data
1063652457_1063652470 29 Left 1063652457 10:7951589-7951611 CCACCCAAAATCATGTCCACCTC 0: 1
1: 0
2: 5
3: 83
4: 562
Right 1063652470 10:7951641-7951663 GAAGGGCATAGATGCAGGGAGGG No data
1063652457_1063652471 30 Left 1063652457 10:7951589-7951611 CCACCCAAAATCATGTCCACCTC 0: 1
1: 0
2: 5
3: 83
4: 562
Right 1063652471 10:7951642-7951664 AAGGGCATAGATGCAGGGAGGGG No data
1063652457_1063652468 25 Left 1063652457 10:7951589-7951611 CCACCCAAAATCATGTCCACCTC 0: 1
1: 0
2: 5
3: 83
4: 562
Right 1063652468 10:7951637-7951659 AGTGGAAGGGCATAGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063652457 Original CRISPR GAGGTGGACATGATTTTGGG TGG (reversed) Intronic
900281986 1:1875843-1875865 CAGGTAGACATGAATTTTGGGGG - Intronic
900507085 1:3035074-3035096 GAGGTGGGCATGGGGTTGGGAGG + Intergenic
900913703 1:5619924-5619946 TCGGTGGACATGAATTTGAGAGG + Intergenic
901384286 1:8897076-8897098 GAGGAGGTGATGATTTTTGGAGG - Intergenic
901442485 1:9286995-9287017 CAGGTGGACATGAATTTTGGGGG + Intergenic
901788766 1:11642242-11642264 GAGGTGGAGATGGACTTGGGGGG + Intergenic
901855554 1:12042122-12042144 TAGGTGGACATATCTTTGGGGGG - Intergenic
902270185 1:15298617-15298639 GTGATAGACATGATATTGGGTGG - Intronic
902643500 1:17781671-17781693 GGGGTAGACATGAATTTTGGGGG + Intronic
905510817 1:38518280-38518302 GAGGTGGACATGAATTTTGGAGG + Intergenic
906087879 1:43151528-43151550 GAGGTGGAGAAGATTGTGGAAGG + Intronic
906508917 1:46400222-46400244 GAGGTGCACATGAGTCTGAGAGG + Intronic
906884495 1:49629798-49629820 GAGGTGGCCATGTTTCTTGGAGG - Intronic
907585605 1:55615270-55615292 CAGGTGGACATGAATTTTGTGGG - Intergenic
907912940 1:58842473-58842495 CAGGGGGACATTATTTTTGGGGG + Intergenic
909282281 1:73770741-73770763 GAGGCAGACAGGATCTTGGGTGG + Intergenic
911202600 1:95060841-95060863 CAGGTGGACATGAATTTTAGGGG - Intronic
911264816 1:95730773-95730795 GAGGTGGACAGAATTGTTGGGGG + Intergenic
911666708 1:100561253-100561275 GAGTTGGAATTTATTTTGGGAGG + Intergenic
911732090 1:101301893-101301915 GAAGAGGACTTGAGTTTGGGAGG - Intergenic
912107570 1:106299024-106299046 GAGGTTGAAATGAGTATGGGGGG + Intergenic
913210733 1:116580252-116580274 CAGGTGGACATGCATTTTGGAGG - Intronic
913461702 1:119093385-119093407 TAGGTAGACATGAATTTTGGAGG - Intronic
913736551 1:121791133-121791155 GAGCTGAACATTATTTTGGGTGG - Intergenic
913746200 1:121907822-121907844 GAGCTGAACATTACTTTGGGTGG - Intergenic
913749377 1:121945028-121945050 GAGCTGAACATTATTTTGGGTGG + Intergenic
913752602 1:122035666-122035688 GAGCTGGACATTCCTTTGGGTGG + Intergenic
913752771 1:122037533-122037555 GAGCTGGACATTCCTTTGGGTGG + Intergenic
913754604 1:122059163-122059185 GAGCTGAACATTATTTTGGGTGG + Intergenic
913765324 1:122183175-122183197 GAGCTGGACATTCCTTTGGGTGG + Intergenic
913767854 1:122212701-122212723 GAGCTGGACATTCCTTTGGGTGG + Intergenic
913769438 1:122232147-122232169 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913769848 1:122237831-122237853 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913769986 1:122239697-122239719 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913770125 1:122241563-122241585 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913770408 1:122245295-122245317 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913770687 1:122249027-122249049 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913770830 1:122250893-122250915 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913770969 1:122252760-122252782 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913771249 1:122256493-122256515 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913771388 1:122258359-122258381 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913771530 1:122260224-122260246 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913771711 1:122262764-122262786 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913771851 1:122264630-122264652 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913771990 1:122266496-122266518 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913772128 1:122268362-122268384 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913772402 1:122272092-122272114 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913772544 1:122273959-122273981 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913772683 1:122275825-122275847 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913772823 1:122277691-122277713 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913772960 1:122279557-122279579 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913773102 1:122281424-122281446 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913773236 1:122283289-122283311 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913773378 1:122285155-122285177 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913773519 1:122287021-122287043 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913773660 1:122288887-122288909 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913773937 1:122292619-122292641 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913774079 1:122294485-122294507 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913774214 1:122296351-122296373 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913774356 1:122298217-122298239 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913774495 1:122300083-122300105 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913774636 1:122301949-122301971 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913774913 1:122305681-122305703 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913775051 1:122307547-122307569 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913775189 1:122309413-122309435 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913775329 1:122311279-122311301 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913775606 1:122315011-122315033 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913775745 1:122316877-122316899 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913775884 1:122318744-122318766 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913776025 1:122320611-122320633 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913776167 1:122322477-122322499 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913776309 1:122324343-122324365 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913776452 1:122326212-122326234 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913776591 1:122328077-122328099 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913776732 1:122329942-122329964 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913776873 1:122331808-122331830 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913777013 1:122333675-122333697 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913777151 1:122335540-122335562 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913777293 1:122337406-122337428 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913777568 1:122341124-122341146 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913777707 1:122342990-122343012 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913777845 1:122344859-122344881 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913778412 1:122352318-122352340 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913778553 1:122354184-122354206 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913778826 1:122357915-122357937 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913778967 1:122359780-122359802 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913779107 1:122361646-122361668 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913779251 1:122363514-122363536 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913779391 1:122365380-122365402 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913779527 1:122367247-122367269 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913779806 1:122370978-122371000 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913780223 1:122376576-122376598 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913780501 1:122380307-122380329 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913780643 1:122382175-122382197 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913780782 1:122384041-122384063 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913780919 1:122385906-122385928 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913781075 1:122387777-122387799 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913781217 1:122389644-122389666 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913781352 1:122391510-122391532 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913781766 1:122397108-122397130 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913781907 1:122398974-122398996 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913782049 1:122400840-122400862 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913782612 1:122408305-122408327 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913782750 1:122410171-122410193 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913782893 1:122412038-122412060 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913783036 1:122413904-122413926 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913783452 1:122419504-122419526 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913783588 1:122421371-122421393 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913783865 1:122425102-122425124 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913784003 1:122426968-122426990 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913784126 1:122428497-122428519 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913784402 1:122432227-122432249 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913784542 1:122434094-122434116 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913784680 1:122435960-122435982 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913785236 1:122443423-122443445 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913785520 1:122447154-122447176 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913786095 1:122454792-122454814 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913786230 1:122456657-122456679 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913786369 1:122458523-122458545 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913786654 1:122462255-122462277 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913786802 1:122464318-122464340 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913786941 1:122466184-122466206 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913787212 1:122469916-122469938 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913787353 1:122471781-122471803 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913787632 1:122475511-122475533 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913787768 1:122477377-122477399 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913787906 1:122479244-122479266 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913788048 1:122481111-122481133 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913788187 1:122482975-122482997 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913788330 1:122484840-122484862 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913788882 1:122492304-122492326 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913789024 1:122494170-122494192 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913789296 1:122497929-122497951 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913789439 1:122499795-122499817 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913789581 1:122501662-122501684 GAGCTGAACATGCCTTTGGGTGG + Intergenic
913925896 1:124892460-124892482 GAGCTGAACATGCCTTTGGGTGG + Intergenic
914453714 1:147816179-147816201 GAGAAGGACATGAATTTTGGGGG - Intergenic
915991473 1:160521463-160521485 GAGGTGGAAATAATTTTGCAGGG + Intronic
916224225 1:162473873-162473895 GATGTGGACATATGTTTGGGAGG - Intergenic
917086693 1:171311180-171311202 GAGGAGGTGATGATTTTTGGAGG - Intergenic
918154333 1:181831088-181831110 GAGGAGGTGATGATTTTGGGGGG - Intergenic
919088987 1:192955832-192955854 TGGGTGGACATGAATTTTGGGGG - Intergenic
919340549 1:196301238-196301260 GAGGTATGAATGATTTTGGGGGG - Intronic
920222898 1:204417031-204417053 GAGGGGGACAGGAGTGTGGGGGG + Intergenic
921314947 1:213881680-213881702 GAGAAGGACATGAATTTGGGTGG + Intergenic
921685485 1:218084234-218084256 GGGGTGGACATAAATTTGGTGGG + Intergenic
922017208 1:221661723-221661745 GAGGTGTACATAATTTTTTGTGG + Intergenic
923971441 1:239207097-239207119 GAGAAGGACATGCTTTTGGGGGG + Intergenic
1063652457 10:7951589-7951611 GAGGTGGACATGATTTTGGGTGG - Intronic
1063985709 10:11499459-11499481 TTGGTGGACATGAGTTTTGGAGG - Intronic
1066220402 10:33332725-33332747 GAGGTGGACATGGCTTTGAGAGG + Intronic
1066386788 10:34948069-34948091 TAGATGGACATGAATTTTGGGGG - Intergenic
1066613842 10:37277084-37277106 GAGGAGATGATGATTTTGGGGGG + Intronic
1066651951 10:37664741-37664763 GAGGTAGACATTTTTGTGGGAGG + Intergenic
1067218515 10:44323792-44323814 CAAGTGGACATGAGTTTTGGGGG - Intergenic
1067396655 10:45926058-45926080 CAGGTGAACATTAATTTGGGGGG + Intergenic
1067674572 10:48360861-48360883 GAGGAGGAGATGATTATGGGGGG + Intronic
1067816534 10:49481852-49481874 GACCTGGACCTGATCTTGGGTGG - Intronic
1067864970 10:49895161-49895183 CAGGTGAACATTAATTTGGGGGG + Intronic
1068501059 10:57840330-57840352 GAGGAGGTGATGATTTTTGGAGG - Intergenic
1069404273 10:68081577-68081599 CAGATGGACATGAATTTTGGGGG + Intergenic
1069508777 10:69024618-69024640 GAAGTGGGCTGGATTTTGGGAGG - Intergenic
1069730645 10:70609782-70609804 CAGAAGGACATGAATTTGGGGGG + Intergenic
1070351111 10:75592976-75592998 GGGGTGGAGATGATTATGGAAGG - Intronic
1070370699 10:75779400-75779422 GGCTTGGACATGACTTTGGGAGG - Intronic
1071338014 10:84617491-84617513 GAGAAGGACATGAATTTTGGGGG + Intergenic
1071880261 10:89889580-89889602 GAGAAGGACATGAATTTTGGGGG + Intergenic
1071884091 10:89930778-89930800 AAGAAGGACATGATTTTTGGAGG + Intergenic
1072058135 10:91781375-91781397 CAGGTGGATATGAATTTGGGAGG + Intergenic
1072242953 10:93514271-93514293 CAAGTGGACATGAATTTTGGGGG + Intronic
1072960856 10:99927766-99927788 GAAATGGAAATGATATTGGGTGG + Intronic
1074670478 10:115784878-115784900 TGGGTGGACATGAATTTTGGAGG + Intronic
1074713504 10:116197659-116197681 CAGGTGGACATGAATTTTGTGGG + Intronic
1074876566 10:117618172-117618194 TGCGTGGACATGAATTTGGGGGG - Intergenic
1075621957 10:123934594-123934616 CAAGTGGACATGAATTTGGTGGG + Intronic
1076803000 10:132841091-132841113 GAGAAGGACATGAGTTTTGGGGG - Intronic
1077378933 11:2219036-2219058 GAGAAGGACATAAATTTGGGGGG - Intergenic
1079146279 11:17855060-17855082 GAAGTTGACGTGATTTTGAGAGG - Intronic
1080208857 11:29761868-29761890 CAGGTGGATATGAATTTTGGAGG - Intergenic
1080464219 11:32481715-32481737 GAGCTGGAAATAATTATGGGAGG - Intergenic
1083451227 11:62746773-62746795 GAGGTGGACAGATTATTGGGAGG - Intergenic
1083717114 11:64583822-64583844 GTGGAGGATAAGATTTTGGGAGG - Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1084447668 11:69213093-69213115 CAGGGGGACATGAATTTTGGCGG - Intergenic
1084715322 11:70869967-70869989 TGGGTGGACATGGATTTGGGGGG - Intronic
1087682598 11:101233101-101233123 GAGGAAGTGATGATTTTGGGGGG + Intergenic
1087901067 11:103641743-103641765 CAGGTGGACATGAATTTTGGGGG - Intergenic
1089850450 11:121491542-121491564 TAGGTGGAGCTGATTTGGGGTGG - Intronic
1089942333 11:122431480-122431502 GAGAAGGACATGAGTTTGGGGGG + Intergenic
1090503708 11:127287013-127287035 GATGTGGACATGTCTTTTGGGGG - Intergenic
1090592838 11:128290861-128290883 GAGGAGGTGAAGATTTTGGGGGG + Intergenic
1091351557 11:134901646-134901668 GAGGTGGACAGGAGTGTGGGAGG - Intergenic
1092862282 12:12728950-12728972 GAGGTGCAGATGAATTAGGGAGG - Intronic
1093346006 12:18038840-18038862 GAGGAGGTGATGATTCTGGGGGG - Intergenic
1093487430 12:19666570-19666592 GAGGAGGACGTGAGTTTTGGGGG + Intronic
1093790677 12:23245813-23245835 GAAAAGGACATGAATTTGGGGGG + Intergenic
1094070438 12:26407078-26407100 GAGGTGGAGATGATTTTGTAAGG - Intronic
1094223786 12:28023757-28023779 GAGGTGGAGATCACTGTGGGGGG + Intergenic
1095290368 12:40472711-40472733 AAGGAAGACATGAATTTGGGTGG + Intronic
1095803781 12:46296344-46296366 GAGGTGGAGAGGATTTTAGTAGG - Intergenic
1095929796 12:47613951-47613973 GAGAAGTACATGAATTTGGGAGG - Intergenic
1098400227 12:70066979-70067001 GAGAAGGACATGAATTTGGGGGG + Intergenic
1099322049 12:81162651-81162673 GAGGTAGACAGGCTTCTGGGTGG - Intronic
1099376990 12:81904049-81904071 GAGGAGGTGATGATTTTTGGAGG - Intergenic
1099579639 12:84427982-84428004 GAGGAGGACATAAATTTGGTGGG + Intergenic
1099665178 12:85619520-85619542 GAGGTGTACCTGCTTTGGGGAGG + Intergenic
1100529449 12:95450378-95450400 GAGGAGGTGATGATTTTTGGAGG + Intergenic
1100616801 12:96237164-96237186 TTGGTGGACATGAATTTGGCAGG + Intronic
1100795735 12:98179908-98179930 CAGGTGGACATGAATTTTAGTGG + Intergenic
1101448086 12:104752409-104752431 TGGGTGGACATGAATTTGGGAGG + Intronic
1101498245 12:105276578-105276600 GATGTGGAAATGAGTTTGGGAGG - Intronic
1101596725 12:106173222-106173244 GAGGTGGCTATGATTATGAGAGG - Intergenic
1102217040 12:111169013-111169035 TAGGTGGACATGAATTTTGGCGG - Intronic
1102423746 12:112824485-112824507 GAGGTGGAGATGCAGTTGGGGGG - Intronic
1102875299 12:116444284-116444306 TGCGTGGACATGAATTTGGGGGG - Intergenic
1103998221 12:124843588-124843610 TAGGTGGGCATGAATTTGGCAGG - Intronic
1104471946 12:129036463-129036485 TGGGTGGACATGACTTTCGGGGG - Intergenic
1106507333 13:30382705-30382727 GAAGGCAACATGATTTTGGGAGG + Intergenic
1106821245 13:33467046-33467068 GGGGTGGGGATGATTTGGGGAGG + Intergenic
1107888948 13:44897179-44897201 GGAGTGGACAAGAATTTGGGAGG + Intergenic
1108832648 13:54498901-54498923 GAGAAGGACATGAAATTGGGAGG + Intergenic
1109426208 13:62168364-62168386 GAGGCAGACAGGGTTTTGGGTGG + Intergenic
1109962273 13:69645849-69645871 GAGATAGACATGATATTTGGCGG + Intergenic
1110810631 13:79807798-79807820 GAGGTGGACAGGCTCCTGGGTGG + Intergenic
1112401977 13:99085990-99086012 GATGGGGACAGGATCTTGGGTGG + Intronic
1112734730 13:102402832-102402854 AAGGTGGAACTGATTTTGGCTGG - Intergenic
1112838805 13:103549985-103550007 CAGGTGGATATGAATTTTGGGGG + Intergenic
1113550723 13:111191144-111191166 GAGGAGGTGATGATTTTGGGGGG + Intronic
1114044435 14:18710292-18710314 GATGTGGGCAGGAGTTTGGGGGG + Intergenic
1114048720 14:18900743-18900765 GATGTGGGCAGGAGTTTGGGGGG + Intergenic
1114113794 14:19500903-19500925 GATGTGGGCAGGAGTTTGGGGGG - Intergenic
1114115494 14:19618654-19618676 GATGTGGGCAGGAGTTTGGGGGG - Intergenic
1114918426 14:27296123-27296145 AAGAAGGACATGAGTTTGGGGGG - Intergenic
1116698106 14:48202103-48202125 GAGGAGGTGATGATTTTGAGGGG - Intergenic
1117305414 14:54468977-54468999 GAGAAGGACATGAATTTGAGGGG + Intergenic
1118700483 14:68427801-68427823 GAGAAGGACATGAATTTGGGGGG + Intronic
1119128433 14:72150034-72150056 CAGGTAGACGTGAATTTGGGAGG - Intronic
1120292321 14:82590785-82590807 GAGAGGGACATAAATTTGGGGGG + Intergenic
1120876977 14:89384002-89384024 CAGGTGGACATGAATTTGGTGGG + Intronic
1121185887 14:91968867-91968889 GAGGTGGCAATGATTATGAGAGG + Exonic
1121215456 14:92244247-92244269 GAGATGGACATAAGTTTTGGGGG - Intergenic
1121222912 14:92299791-92299813 GAGGTGGAGGTGATGATGGGAGG + Intergenic
1121740384 14:96247940-96247962 CATGTGGACATGAGTTGGGGTGG - Intronic
1121814116 14:96915960-96915982 TGGGTGGACATGAATTTTGGGGG + Intronic
1121833461 14:97071686-97071708 TGGGTGGACATGAATTAGGGTGG - Intergenic
1122016283 14:98799505-98799527 GAGAAGGACATGAATTTGGGGGG + Intergenic
1122995158 14:105259612-105259634 CCGGTGGACATGGTTTTGAGAGG - Intronic
1123010648 14:105348058-105348080 GGGGTGGGCAGGATTTGGGGCGG + Intronic
1123068959 14:105631901-105631923 GAGAAGGACATGATTATGGGGGG - Intergenic
1123073116 14:105651859-105651881 GAGAAGGACATGATTATGGGGGG - Intergenic
1123093036 14:105750629-105750651 GAGAAGGACATGATTATGGGGGG - Intergenic
1123098509 14:105777726-105777748 GAGAAGGACATGATTATGGGGGG - Intergenic
1123107429 14:105849130-105849152 GAGAAGGACATGATTATGGGGGG + Intergenic
1123504817 15:20930633-20930655 GATGTGGGCAGGAGTTTGGGGGG + Intergenic
1123562065 15:21504328-21504350 GATGTGGGCAGGAGTTTGGGGGG + Intergenic
1123598310 15:21941615-21941637 GATGTGGGCAGGAGTTTGGGGGG + Intergenic
1124010193 15:25831912-25831934 CAGATGGACATGAATTTTGGGGG - Intronic
1124500140 15:30221083-30221105 GAGGGGGCCATGACCTTGGGTGG + Intergenic
1124743435 15:32317583-32317605 GAGGGGGCCATGACCTTGGGTGG - Intergenic
1124878794 15:33622302-33622324 GAGGTGGAGAAGACCTTGGGTGG - Intronic
1126070830 15:44863587-44863609 GAGGAGGTAATGATTTTTGGAGG + Intergenic
1126073470 15:44886187-44886209 GAGAAGGACATGAGTTTGGGGGG - Intergenic
1126084793 15:45001438-45001460 GAGAAGGACATGAGTTTAGGGGG + Intergenic
1126921230 15:53527381-53527403 GATGTGGAAATGTTTCTGGGGGG - Intronic
1127043513 15:55002414-55002436 TAAGAGGACATGAGTTTGGGAGG - Intergenic
1127862636 15:63007111-63007133 AGGGTGGACATGAGTTTGGGGGG - Intergenic
1129505704 15:76079808-76079830 TAGGTAGATATGATTTAGGGCGG + Intronic
1129690127 15:77708474-77708496 CAGATGGACATGAATTTGGGGGG - Intronic
1130856161 15:87841613-87841635 GAGGTGGACAGGTTCCTGGGTGG - Intergenic
1131263435 15:90902130-90902152 GATTTGAACATGAATTTGGGGGG + Intergenic
1131369154 15:91865360-91865382 GAGGTGGACATGGGCTTGGAGGG + Intronic
1131411721 15:92213121-92213143 GAGGAGGTAATGATTTTTGGAGG - Intergenic
1131453478 15:92565167-92565189 GAGAAGGACATGAATTTGGGGGG - Intergenic
1202970410 15_KI270727v1_random:231467-231489 GATGTGGGCAGGAGTTTGGGGGG + Intergenic
1133623017 16:7544355-7544377 CAAGTGGACATAAATTTGGGGGG - Intronic
1133689846 16:8202748-8202770 CAGGTGGACATGAATTTTGAGGG + Intergenic
1134341173 16:13347841-13347863 GATGTGGACATCTTTGTGGGGGG - Intergenic
1134818934 16:17229802-17229824 TGAGTGGACATGATTTTGGAGGG - Intronic
1135933428 16:26759016-26759038 GAGGTGGACCTTCTATTGGGAGG + Intergenic
1136748050 16:32609569-32609591 GAGGAGGAAATGAGTTTGGTAGG + Intergenic
1137259471 16:46812514-46812536 GAGGTAGACAGGATTGTGGATGG + Intronic
1138290031 16:55839065-55839087 GAGATGGACAAAATTTGGGGAGG + Intergenic
1138613804 16:58148361-58148383 TGGGTGGACATGAATTTTGGGGG + Intergenic
1138752255 16:59438137-59438159 CAGGTAGGCATGAATTTGGGGGG - Intergenic
1139320732 16:66111794-66111816 GAGAAGGACATGAATTTGGTGGG + Intergenic
1140662823 16:77204298-77204320 CTGGTGGACATGAATTTTGGAGG - Intronic
1140756826 16:78075208-78075230 GATGTGGACATGCATTTTGGGGG - Intergenic
1141437965 16:84011581-84011603 CAGGTAGACATGAATTTTGGGGG - Intronic
1141799252 16:86296000-86296022 GAGGTGGGCATTGTATTGGGGGG - Intergenic
1203050187 16_KI270728v1_random:868776-868798 GAGGAGGAAATGAGTTTGGTAGG + Intergenic
1143455867 17:7067323-7067345 GAGAAGGACATGAGATTGGGAGG - Intergenic
1144637286 17:16918331-16918353 GAGGAGGTCAAGATTATGGGGGG + Intergenic
1144649787 17:17000087-17000109 GAGGTGGAAATGAGTGTGGAGGG + Intergenic
1146159077 17:30549960-30549982 GAGGTGGACAGGATGTCGGAGGG - Intergenic
1146311250 17:31770113-31770135 GAGGAGGTGATGATTTTTGGGGG - Intergenic
1146319994 17:31839602-31839624 GAAGTAGACATAATTTTGGGAGG - Intergenic
1146739160 17:35266213-35266235 GAGGGGGTGATTATTTTGGGTGG + Exonic
1146915156 17:36673609-36673631 GAGGTGGACTTGACCCTGGGAGG + Intergenic
1147347801 17:39814474-39814496 CAGGAGGACATGAATTTAGGAGG - Intronic
1147638905 17:41981854-41981876 GAGGAGGGCATGAATATGGGTGG - Exonic
1148091907 17:45027640-45027662 GAGGTGGCCATGGGTTTTGGTGG - Intronic
1149074468 17:52579513-52579535 GAGGATGTGATGATTTTGGGGGG - Intergenic
1149213790 17:54331276-54331298 GCGGAGGTCATGATTTTTGGGGG - Intergenic
1149656838 17:58314294-58314316 AACATGGACATGTTTTTGGGCGG - Intronic
1149677898 17:58482848-58482870 GAGGATGACTTGATCTTGGGAGG + Intronic
1149948639 17:60960099-60960121 GATGTGGACATGTCTTTTGGGGG + Intronic
1150773072 17:68058108-68058130 GAAGGGGACATGATTGTAGGTGG - Intergenic
1151222784 17:72625597-72625619 CAGGTGGACATGGATTTTGGTGG + Intergenic
1151363296 17:73601383-73601405 TGGGTGGACATGAATTTGGGGGG - Intronic
1151944261 17:77310964-77310986 TTGGTGGACATGAGTTTGTGGGG - Intronic
1152261352 17:79268966-79268988 TAGGTAGACATGAATTTGGGGGG - Intronic
1152297170 17:79474825-79474847 GATGTGGACACATTTTTGGGTGG - Intronic
1152867682 17:82734209-82734231 GAGGTGGAAATGATGGTGTGTGG + Intergenic
1155072212 18:22326584-22326606 TAGGTGGACATGAATTTTGGAGG - Intergenic
1158802559 18:60929903-60929925 TGGGTGGACATGAATTTTGGAGG - Intergenic
1158904672 18:62000632-62000654 GAGAAGGACATGAAATTGGGAGG - Intergenic
1158968838 18:62647342-62647364 AAGTTGAACATGATTTTGGAAGG - Intergenic
1159548138 18:69866678-69866700 GAGGAGGACATGAATTTGCAGGG - Intronic
1159654794 18:71020064-71020086 GAGATGGACATGAGTTATGGTGG + Intergenic
1159724142 18:71932567-71932589 GAGGTACATCTGATTTTGGGGGG - Intergenic
1159881053 18:73858965-73858987 TGGGTGGACATGAATTTTGGGGG - Intergenic
1160186283 18:76678996-76679018 GAGGTGGCCATGAACTGGGGTGG - Intergenic
1160411608 18:78678786-78678808 CAGGTGGACCTGAATTTGGAGGG + Intergenic
1160971464 19:1769585-1769607 GGGGTGAACCTGATGTTGGGTGG + Intronic
1161228694 19:3161323-3161345 CAGGTGGACATGAATTTTGGGGG + Intronic
1161512458 19:4679262-4679284 GGGGTGGGCATGGTTATGGGCGG - Intronic
1161757296 19:6143542-6143564 TGGGTGGACATGAATTTTGGAGG + Intronic
1162236767 19:9315702-9315724 GAGGAGGTGATGATTTTAGGGGG + Intergenic
1162490755 19:10990077-10990099 GAGGAGGACATGAGCCTGGGAGG - Intronic
1162498665 19:11038375-11038397 CAGGTAGACATGAGTCTGGGGGG + Intronic
1163147910 19:15394407-15394429 GAGGAGGACAAGAGGTTGGGGGG + Intronic
1164531183 19:29049367-29049389 GTGGTGGATATGAATTTTGGGGG + Intergenic
1165194059 19:34087431-34087453 GAGGTGGGGATCATTGTGGGGGG + Intergenic
1165529637 19:36387239-36387261 GAGAAGAACATGAATTTGGGAGG + Intronic
1165765202 19:38346231-38346253 GAGGTGGGCATGTTCCTGGGAGG + Intronic
1167841472 19:52125129-52125151 GAGGAGTACATGAATTTTGGTGG - Intronic
925490019 2:4381029-4381051 AAAGTGGACAAGATTTTTGGAGG + Intergenic
925665984 2:6256874-6256896 CTGGTGGACATGAATTTTGGGGG - Intergenic
927516548 2:23675000-23675022 GAGGTGGAGAGGACTTTGTGTGG - Intronic
927666053 2:25033552-25033574 GAGGTGGTCATGAGTCAGGGAGG + Intergenic
928697306 2:33862181-33862203 CAGGTGGACATAAATTTTGGAGG + Intergenic
929245283 2:39695597-39695619 GAGATGGACATGATGTTGCCAGG + Intronic
929542428 2:42832486-42832508 GAGGTGGACATGTTTCTGGGGGG - Intergenic
929684001 2:44018785-44018807 GAGGTGGCGAAAATTTTGGGGGG + Intergenic
929903947 2:46029836-46029858 GAGGAGGAAATGATGTTTGGAGG + Intronic
930560187 2:52950737-52950759 GAGGTTGACATGATCTCAGGTGG - Intergenic
932101975 2:68909148-68909170 GAGATGGAGATGATATTGGGAGG + Intergenic
932260016 2:70319029-70319051 GAGGTGGACAGCATTTGGAGTGG + Intergenic
932326193 2:70863471-70863493 TGGGTGGACATGAATTTGGAGGG + Intergenic
932373002 2:71208589-71208611 GACATGGACATATTTTTGGGGGG - Intronic
934695501 2:96397217-96397239 GAGAAGGACATGAATTTTGGGGG - Intergenic
935556399 2:104513976-104513998 AAGGAGGACATGAGTTTGGAAGG + Intergenic
936471125 2:112799437-112799459 GAGGAGGAAATGGTTTGGGGTGG + Intergenic
936487450 2:112938431-112938453 GAAATGGAAATGTTTTTGGGGGG + Intergenic
936968225 2:118148140-118148162 TGGGTGGACATGAATTTTGGAGG + Intergenic
937653208 2:124344201-124344223 GAGAAGGACATGAGTTTTGGGGG - Intronic
938040135 2:128069021-128069043 GAAGTGGACTACATTTTGGGGGG - Intergenic
938426082 2:131189250-131189272 GATGTGGGCAGGAGTTTGGGGGG + Intronic
938764943 2:134454622-134454644 CAGGTGGAAGTGATTTTTGGGGG + Intergenic
939852385 2:147317482-147317504 GAGGAGGCAATGATTTTTGGAGG - Intergenic
940174436 2:150863158-150863180 GAGAAGGACATAAATTTGGGGGG - Intergenic
942624490 2:177884988-177885010 GAGGTGGAGAAGATTTGGGATGG + Intronic
943325609 2:186493944-186493966 CAGGTGGACTTGAATTTTGGGGG + Intronic
943633389 2:190279350-190279372 GAGAAGGATATGAGTTTGGGAGG - Intronic
943759533 2:191593029-191593051 GATGTGGACATCTTTGTGGGGGG + Intergenic
944304984 2:198169102-198169124 CAGGTGGCCATGAATTTGGGTGG + Intronic
944472826 2:200073143-200073165 CAGGTGGACATGAATTTTTGAGG + Intergenic
944505912 2:200410556-200410578 GAGTTGGACATGATTAGGGAGGG - Intronic
944545886 2:200798473-200798495 CAGGTAGACATGAATTTGGGGGG + Intergenic
945272872 2:207959388-207959410 GAGGTTCAGATTATTTTGGGGGG + Intronic
945471540 2:210233426-210233448 GACTTGGACATATTTTTGGGGGG - Intergenic
947456296 2:230257087-230257109 GAGGTGGGCATGGGTTGGGGTGG + Intronic
947468044 2:230371777-230371799 GAGGTGGACGTTTTTTGGGGTGG - Intronic
947831296 2:233143774-233143796 GAGGTGGTCATGATCATGGGAGG + Intronic
947831396 2:233144245-233144267 GAGGTGGTCATAATTATGGTGGG + Intronic
947831502 2:233144718-233144740 GAGGTGGGCATGATCATGGTGGG + Intronic
948320830 2:237067687-237067709 CAGGTGAGCATGAATTTGGGGGG + Intergenic
948373201 2:237503826-237503848 GAAGTAGACATCTTTTTGGGGGG - Intronic
948928057 2:241112165-241112187 GAGGGTGGCTTGATTTTGGGTGG - Intronic
1169131089 20:3166721-3166743 GAGGTGGCCAGGAGCTTGGGTGG + Exonic
1169303955 20:4471940-4471962 GAGGTGGAAATGAGTCTGTGAGG - Intergenic
1169355531 20:4901771-4901793 GAGGTTACCATGATTGTGGGTGG + Intronic
1173292711 20:41728537-41728559 GAGGACGACATGAATTTTGGAGG + Intergenic
1173560329 20:44000456-44000478 GAGGTGGAGAAGACTGTGGGAGG + Intronic
1174317228 20:49712962-49712984 GAGGTGAACGTGAGTTAGGGAGG + Intronic
1174459835 20:50674516-50674538 TGGGTGGACATGAATTTTGGGGG - Intronic
1175119623 20:56708062-56708084 CTGGTGGACATGAATTTTGGAGG + Intergenic
1175323956 20:58109828-58109850 GAGAAGGACATGAATTTGGGGGG + Intergenic
1175761399 20:61564232-61564254 CTGGTGGACGTGAATTTGGGAGG + Intronic
1175823171 20:61923004-61923026 CAGGTGGACATGTCTTTTGGGGG + Intronic
1176069452 20:63218504-63218526 CAGGTGGACATGAGTTTTGGGGG + Intergenic
1176114464 20:63425317-63425339 AAGATGGACATGAATTTTGGGGG - Intronic
1178625805 21:34217518-34217540 GGGGTGGACAGGAGTCTGGGAGG + Intergenic
1178839168 21:36124966-36124988 CAGGTGGACATGAATTTTGAGGG - Intergenic
1179370541 21:40802458-40802480 GAGAAGGACATGAGTTTTGGGGG + Intronic
1179472783 21:41622651-41622673 CAGGTGGACACGAATTTTGGGGG + Intergenic
1179925424 21:44531560-44531582 TGGGTGGACATGAATTCGGGGGG + Intronic
1180467255 22:15623403-15623425 GATGTGGGCAGGAGTTTGGGGGG + Intergenic
1181758830 22:25043700-25043722 GGGTTGGCCATGCTTTTGGGTGG + Intronic
1182985749 22:34714494-34714516 CAGATGGACATGAGTTTTGGGGG - Intergenic
1183333057 22:37231670-37231692 GAGGCGGACATGAGGTTGTGTGG + Intronic
1183397011 22:37577312-37577334 CAGGTGGACATGAATTTTCGGGG - Intronic
1183569365 22:38640760-38640782 GAGGTGGACATGAGTGTTGGTGG + Intronic
1184775595 22:46621300-46621322 GAGGTGGACATGAATTTTGGGGG - Intronic
949476121 3:4447496-4447518 GTAGGGGAGATGATTTTGGGTGG - Intronic
949797990 3:7871925-7871947 GTGGTGGTCATGATTTTGGAAGG - Intergenic
949914863 3:8952136-8952158 GAGAAGAACATGAATTTGGGAGG - Intronic
950534554 3:13571508-13571530 GATGTGGACAGGATGTTGTGGGG - Exonic
951377497 3:21938714-21938736 GAGGTGGACATTAGTTTTAGGGG - Intronic
952392554 3:32892830-32892852 GACGTGGACATGAATGTGGGTGG + Exonic
952487438 3:33828678-33828700 GAAGACGACATGATTTTGTGTGG - Intronic
952610504 3:35203253-35203275 TGGGTGGACAAGAATTTGGGTGG - Intergenic
952905506 3:38137180-38137202 GAGGTGGACGGGACTTTTGGAGG - Exonic
953341993 3:42142207-42142229 CAGGTGGACATTATCTTTGGAGG + Intronic
954342617 3:49967694-49967716 GACCTGGACATGATTTCAGGGGG + Exonic
954990635 3:54837937-54837959 TGGGTGGACATGAACTTGGGGGG + Intronic
956704400 3:71986954-71986976 TAGGTGGACATATTTTTAGGGGG - Intergenic
956852549 3:73243739-73243761 TATGTGTACATGATTTTGTGTGG - Intergenic
958419279 3:93912935-93912957 GAGAAGGACATGAATTTTGGGGG - Intronic
958977421 3:100682941-100682963 GAGGCAGACAGGCTTTTGGGTGG + Intronic
959712784 3:109401569-109401591 ATGATGGACATGAATTTGGGGGG + Intergenic
959808750 3:110591918-110591940 GAGAAGGACATGAGTTTTGGGGG - Intergenic
961296324 3:125887399-125887421 AAGGTGCACATGTTTGTGGGAGG - Intergenic
964085703 3:152815664-152815686 GAAAAGGACATGATTTGGGGTGG - Intergenic
965644163 3:170862528-170862550 GAGGTGGGGATCATTTTGGGGGG - Intergenic
966534056 3:181011276-181011298 AAGAAGGACATGAATTTGGGGGG + Intergenic
966862012 3:184235848-184235870 GAGGTGTACATGACTGTGTGTGG - Intronic
969051605 4:4377200-4377222 CAGATGGACATGAATTTTGGGGG + Intronic
969158866 4:5237737-5237759 GAGGTGGCCATGATGGGGGGAGG - Intronic
969172300 4:5373910-5373932 CAGGTGGACATTACTTTTGGGGG - Intronic
969754057 4:9136014-9136036 AAGGTGCACATGTTTTGGGGAGG - Intergenic
969813948 4:9672139-9672161 AAGGTGCACATGTTTTGGGGAGG - Intergenic
969977588 4:11119851-11119873 GAGGTGGACCTCTTTTTGTGGGG - Intergenic
970074159 4:12198551-12198573 GAGAAGGACATGAATTTTGGAGG + Intergenic
970535741 4:17028197-17028219 CAGGTGGACATGGATTTGGTGGG - Intergenic
973558833 4:52113568-52113590 GAGGTGGGTGGGATTTTGGGTGG + Intergenic
973992252 4:56421402-56421424 GAGGGGGCCATGGTTTTGGGAGG - Intronic
974527276 4:63060477-63060499 GAGGAGGTGATAATTTTGGGGGG - Intergenic
974535448 4:63168143-63168165 TAGGTGGACATGAAATTTGGAGG - Intergenic
976006518 4:80436704-80436726 GAGATAAAGATGATTTTGGGGGG + Intronic
976273497 4:83252831-83252853 GATGTCAACATGAATTTGGGGGG + Intergenic
976663120 4:87561213-87561235 GAGGTGGACATGAATTTTGGGGG - Intergenic
977531029 4:98200634-98200656 CAGGTAGACATGAATTTTGGGGG - Intergenic
977884908 4:102243642-102243664 GAGGAGGTGATGATTTTGGGGGG - Intergenic
977924301 4:102682564-102682586 TGGGTGGACATGAATTTTGGGGG - Intronic
978849634 4:113317899-113317921 GAATTGGGAATGATTTTGGGGGG - Intronic
978937532 4:114396216-114396238 TAGATGGACATGAATTTGGGGGG + Intergenic
979970971 4:127134784-127134806 CAGCTGGGCATGATTTTGGATGG - Intergenic
979994914 4:127420205-127420227 GAAGGGGACAGTATTTTGGGAGG - Intergenic
981888375 4:149706368-149706390 GAGGCAGACATGGATTTGGGGGG + Intergenic
982419422 4:155177081-155177103 GAGAAGGACATGAATTTGGGGGG - Intergenic
983010181 4:162537350-162537372 GAGGAGGGCATGGTGTTGGGAGG + Intergenic
983769837 4:171535598-171535620 GAGGTGGGCAGCACTTTGGGAGG + Intergenic
984806016 4:183752545-183752567 CAGGTGGACATGAATTTGGTGGG + Intergenic
986214686 5:5708322-5708344 GAGGTGGACATCTTTTCGTGGGG + Intergenic
986422936 5:7602212-7602234 CAAGTGGACATAATTTTTGGTGG + Intronic
986806788 5:11314814-11314836 AATGGGGACATGATTTGGGGAGG + Intronic
986897943 5:12393674-12393696 CATGTGGACATGAATTTCGGAGG - Intergenic
987108443 5:14663456-14663478 TAGGTGGACGTGAATTTTGGGGG + Intergenic
987220718 5:15788254-15788276 TGGGTGGACATGAATTTTGGGGG + Intronic
987473177 5:18357336-18357358 GAACTGGACATCATTTTGGCTGG + Intergenic
988389683 5:30611767-30611789 CAGGTGGACATTAATTTGGGTGG - Intergenic
989262259 5:39431198-39431220 TAGGTAGACATGAATTTTGGAGG - Intronic
989311080 5:40018632-40018654 GAGAAGGACATGATTTTGGTGGG + Intergenic
991689729 5:69214408-69214430 GAGTAGGACATAAATTTGGGGGG + Intergenic
992006811 5:72486462-72486484 GAGGTACACAGGATGTTGGGAGG - Intronic
992050103 5:72933864-72933886 GAGGAGGTGATGATTTTTGGGGG - Intergenic
992415600 5:76549942-76549964 GAGGAGGACATGAATTTTGGGGG - Intronic
992864918 5:80948450-80948472 GAGGTGGAAAGGAGTTGGGGAGG - Intergenic
993742050 5:91553645-91553667 CAGGTGGACATGAATTTTGGAGG - Intergenic
994231010 5:97310647-97310669 GAGGAGGTGATGATTTTTGGGGG + Intergenic
994377499 5:99031594-99031616 GATGTTGACATGTTTTTAGGTGG - Intergenic
994448728 5:99912058-99912080 GAGGGGGACATGATATAGGAGGG - Intergenic
995336225 5:111002661-111002683 GAGAAGGACATGAATTTGGTGGG + Intergenic
995572252 5:113492411-113492433 GAGAAGGACATAAGTTTGGGGGG + Intergenic
995593029 5:113719580-113719602 GAGAAGGACATGAATTTTGGGGG + Intergenic
995683561 5:114746286-114746308 GAGGTGGACATGAGATTTGGGGG + Intergenic
996680942 5:126227720-126227742 GAGGAGGTGATGATTTTTGGGGG - Intergenic
996926270 5:128830130-128830152 GAAGTGGACTTGATCTTGGCAGG + Intronic
998037300 5:138927803-138927825 GAGGTAGAGATGATGTTAGGAGG + Intronic
998589613 5:143463706-143463728 GAGAAGGACATGAGTTTTGGGGG - Intergenic
998713132 5:144849238-144849260 GAGGAGGTGATGATTTTTGGAGG + Intergenic
998778922 5:145634451-145634473 GAGGTGAGAATGATTTTGGTGGG - Intronic
999058429 5:148607495-148607517 AAAGTGGAAATGATGTTGGGAGG - Intronic
999344490 5:150804174-150804196 GAAGTGGACATAATTTTGGGGGG - Intergenic
1000047169 5:157531298-157531320 GAGGTGGACATGAATTTTAGGGG - Intronic
1001268127 5:170289977-170289999 GAGGTGGACATGAGCCTGGCTGG + Intronic
1001988074 5:176092890-176092912 GAGGAGGAAATGACTTTGGCAGG + Intronic
1001989283 5:176102921-176102943 GAGGAGGAAATGACTTTGGCAGG + Intronic
1001989961 5:176108244-176108266 GAGGAGGAAATGACTTTGGCAGG + Intronic
1002226909 5:177729894-177729916 GAGGAGGAAATGACTTTGGCAGG - Intronic
1002228794 5:177745250-177745272 GAGGAGGAAATGACTTTGGCAGG - Intronic
1002266552 5:178038533-178038555 GAGGAGGAAATGACTTTGGCAGG + Intronic
1004078890 6:12371127-12371149 AAGGTGGAGATTATATTGGGTGG - Intergenic
1004323503 6:14652200-14652222 GATGTGGACATATCTTTGGGAGG - Intergenic
1004532059 6:16462878-16462900 GAGGAGGTGATGATTTTTGGGGG - Intronic
1006443551 6:34066657-34066679 GAGGTAACCATGATTTTGAGAGG - Intronic
1007076152 6:39067669-39067691 GAGGAGGACAGGAATTTGGGGGG - Intronic
1007083058 6:39122458-39122480 GAGGTGGTGAAAATTTTGGGGGG - Intergenic
1007539454 6:42627585-42627607 GAGGTTGGCTTGAATTTGGGTGG - Intronic
1008230634 6:48982332-48982354 CAGGTGGACCTGATTTTTTGGGG + Intergenic
1009385237 6:63079175-63079197 GAGGAGGTGATGATTTTTGGTGG + Intergenic
1009475614 6:64087368-64087390 GAGTTGCACATGTTTTTGGGAGG + Intronic
1009562715 6:65269934-65269956 GAGAATGACATGAATTTGGGGGG - Intronic
1011374329 6:86673739-86673761 GAGGAGTTGATGATTTTGGGGGG + Intergenic
1013227408 6:108130024-108130046 GAGAAGGATATGAATTTGGGGGG - Intronic
1013249574 6:108320884-108320906 GAGGAGAACAGGATTGTGGGAGG + Intronic
1013343648 6:109238743-109238765 CAGGTAGACATGAATTTTGGGGG + Intergenic
1013540615 6:111104511-111104533 GCTGTCGACATGATTTTGTGGGG - Intronic
1013710966 6:112897928-112897950 GAGTTTGACATGAATTTTGGGGG + Intergenic
1013907121 6:115233522-115233544 GAGGAGGTGATGATTTTTGGGGG + Intergenic
1014108415 6:117592743-117592765 GGGGTGGATATGAATTTTGGAGG + Intronic
1014411985 6:121135943-121135965 GTGGTGGACATTTTTTTGGTGGG - Intronic
1014956542 6:127625126-127625148 GAGATGGAAATCATTTTGGAGGG - Intergenic
1014961707 6:127694852-127694874 GAAGAGGACATGAATTTTGGAGG - Intergenic
1015146417 6:129992633-129992655 AAGGTGGATATGATTTTTGTAGG + Intergenic
1015232298 6:130929281-130929303 GAGGAGGAAATGATTTTTTGAGG + Intronic
1015547018 6:134371543-134371565 CAGGTAGACATGATATTTGGGGG + Intergenic
1015949916 6:138541986-138542008 TGAGCGGACATGATTTTGGGAGG - Intronic
1017101681 6:150854667-150854689 GAGGAGGTGATGATTTTTGGGGG - Intergenic
1018040864 6:159921031-159921053 CAGGTGGACAGGAATTTTGGGGG - Intergenic
1018483166 6:164212617-164212639 GAGAAGAACATGAATTTGGGGGG - Intergenic
1018568660 6:165184301-165184323 CAGGTGGACATGAATTTTGGAGG + Intergenic
1019065975 6:169298134-169298156 TAGGTGGACATGAATTTTGGGGG - Intergenic
1019332571 7:467662-467684 GAGGTGGTAATGCTTGTGGGAGG - Intergenic
1019769607 7:2875516-2875538 GAGGTGGAGGTGATCCTGGGAGG - Intergenic
1020121288 7:5505178-5505200 TATGTGGACATGGTTCTGGGAGG - Intronic
1022703306 7:32781320-32781342 GAGAAGGACATGATATTTGGGGG - Intergenic
1022770521 7:33467181-33467203 GATGGGGACTTGATTCTGGGGGG + Intronic
1022907544 7:34871454-34871476 GAGAAGGACATGATATTTGGGGG - Intronic
1023839780 7:44090176-44090198 TGGGTGGAAATGAATTTGGGGGG + Intergenic
1024149154 7:46551883-46551905 AAGGTGGACATGGTGGTGGGAGG + Intergenic
1024218597 7:47269152-47269174 GAGGAGGATATTAATTTGGGGGG - Intergenic
1024246213 7:47472252-47472274 CAGGTGGACATGAATTTCGGGGG + Intronic
1024436720 7:49365302-49365324 GAGAAGAACATGAATTTGGGAGG - Intergenic
1025058303 7:55783105-55783127 GAGCAGTACATGAATTTGGGTGG - Intergenic
1025828108 7:65026881-65026903 GAGAAGGACATGAATTTGGGTGG + Intergenic
1025915638 7:65863314-65863336 GAGAAGAACATGAATTTGGGTGG + Intergenic
1026656823 7:72263878-72263900 CAGGAGGACATTAATTTGGGGGG - Intronic
1027638742 7:80707796-80707818 GAAGTAGACATGGTTTTGGCTGG + Intergenic
1027791762 7:82644100-82644122 GAGGAGGTGATGATTTTTGGAGG - Intergenic
1028724189 7:94069034-94069056 GAGATGGAGATGATGATGGGAGG + Intergenic
1028972337 7:96872713-96872735 CAGGTGGACATGAATTTTGGGGG + Intergenic
1029952646 7:104603444-104603466 GAGGAGAACATGAATTTTGGGGG - Intronic
1030749328 7:113211190-113211212 GAGAAGGACATGAATTTGGGGGG - Intergenic
1031182276 7:118433643-118433665 GAGAAGGACATGAGATTGGGAGG + Intergenic
1031885606 7:127243056-127243078 GATGGGGACATTATTTTGGGGGG - Exonic
1033591144 7:142809364-142809386 GAGGTGGAAGGGAGTTTGGGGGG - Intergenic
1034070207 7:148177162-148177184 TAGGTGGACATGAATTTTGGGGG - Intronic
1034408584 7:150923685-150923707 CAGGTGGACATGGATTTTGGGGG - Intergenic
1034463895 7:151214287-151214309 GAGTTGGATATGGGTTTGGGGGG - Intronic
1035548208 8:499866-499888 GAGGTGGACAAAATCTTAGGTGG + Intronic
1036237848 8:7056811-7056833 GAGGTGGGCATGTGATTGGGAGG + Intergenic
1036377272 8:8211351-8211373 AAGGTGCACATGTTTTGGGGAGG - Intergenic
1036852276 8:12211800-12211822 AAGGTGCACATGTTTTGGGGAGG + Intergenic
1036873644 8:12454321-12454343 AAGGTGCACATGTTTTGGGGAGG + Intergenic
1037378670 8:18261141-18261163 GAGGTGTACATAATTTTAGGAGG - Intergenic
1037464691 8:19148737-19148759 CAGGTAGACATGAATTTTGGAGG - Intergenic
1037484820 8:19337376-19337398 TAGGTGGACATAAATTTCGGGGG - Intronic
1037627347 8:20619633-20619655 CAGGTGAACATGAATTTTGGTGG - Intergenic
1037660996 8:20926759-20926781 CAGGTGGACATGAATTTTGAGGG + Intergenic
1038430235 8:27494077-27494099 GAGGAGGTGATGATTTTGGGGGG + Intronic
1039083799 8:33759914-33759936 GAGAAGGACATGAGTTTGAGGGG - Intergenic
1039506873 8:38058556-38058578 GAGAAGGACATGAGTTTGGGGGG - Intronic
1040741442 8:50580431-50580453 TGGGAAGACATGATTTTGGGAGG + Intronic
1040950440 8:52934080-52934102 GAGAAGGACATGAATCTGGGGGG - Intergenic
1041067181 8:54093242-54093264 CAGGTGGATGTGAATTTGGGGGG - Intronic
1041136333 8:54763043-54763065 TAGGTGGCCATGAATTTTGGGGG + Intergenic
1041821065 8:62033380-62033402 CAGGTGGACATGAGTTTGAGGGG + Intergenic
1042191092 8:66187873-66187895 GAGGTGGACAGAAACTTGGGAGG + Intergenic
1043446709 8:80326239-80326261 GATGTGGACATCTTTTTTGGGGG + Intergenic
1043543747 8:81292429-81292451 GAGGTGGACATAACTTGGTGTGG + Intergenic
1044339742 8:91033295-91033317 GAGTTGGCCATGTGTTTGGGAGG - Intronic
1044813041 8:96083322-96083344 GATGTGGATATGATGGTGGGTGG + Intergenic
1045176886 8:99735272-99735294 CAGGTAGAAATGAATTTGGGAGG - Intronic
1045245301 8:100437144-100437166 CAGGTGAACATGAGTTTGAGGGG - Intergenic
1045486110 8:102633023-102633045 CTGGTGGACATGAATTTTGGAGG - Intergenic
1047006406 8:120624608-120624630 GAGGAGGACATGAATTTTTGGGG - Intronic
1047105522 8:121726847-121726869 AAGAAGGACATGAATTTGGGGGG - Intergenic
1047724259 8:127670532-127670554 GAGGTGGGAATGCTTTTGGGTGG - Intergenic
1047853794 8:128887739-128887761 GAGGTGGGAATGCTTTTTGGTGG + Intergenic
1049227090 8:141459691-141459713 GTGGTGGAGGTGATTTTGGTTGG + Intergenic
1049320952 8:141996049-141996071 TAGGTGGACATGAATTTTGGGGG + Intergenic
1049483618 8:142839866-142839888 AAGGAAGACTTGATTTTGGGAGG + Intronic
1050291744 9:4162344-4162366 CAGGTGGGCATTAATTTGGGGGG + Intronic
1050692444 9:8243043-8243065 CAGGTGGAGATGAATTTGGATGG + Intergenic
1050935297 9:11387777-11387799 GAGGAGGACATGAGATTTGGGGG + Intergenic
1051518479 9:17957620-17957642 TAAGTGGACATGAATTTGGGGGG - Intergenic
1051807039 9:21006105-21006127 GAGGAGGACATGAATTTTGTAGG + Exonic
1051927440 9:22346053-22346075 TGTGTGGAGATGATTTTGGGAGG + Intergenic
1053341777 9:37342290-37342312 GAGATGGGAAAGATTTTGGGAGG + Intronic
1053727678 9:41020921-41020943 GCAGTGGGAATGATTTTGGGTGG - Intergenic
1055339629 9:75267115-75267137 GAGATGGACATGATTATGTTGGG - Intergenic
1055830112 9:80368258-80368280 CAGGTGAATATGAATTTGGGGGG - Intergenic
1055840143 9:80493778-80493800 GAGAAGGACATGAATTTTGGAGG - Intergenic
1056255460 9:84795011-84795033 AAGGTAGACATTAATTTGGGGGG - Intronic
1057242504 9:93423700-93423722 GTGGTGGACATGGTTTTGTGGGG + Intergenic
1057477458 9:95414941-95414963 GAGAAGGACATGAATTTTGGGGG - Intergenic
1057677039 9:97144004-97144026 GAGATGGATATGATATTTGGGGG - Intergenic
1057717804 9:97508745-97508767 TAGGTGGGCATGACTTTTGGGGG - Intronic
1057792665 9:98134396-98134418 CAGGTGGACATGAGTTTTGGGGG - Intronic
1057874382 9:98742851-98742873 GAGGGGGAGATGAATTTGAGAGG + Intronic
1058789450 9:108427602-108427624 GTGGTGGCCAGGGTTTTGGGAGG - Intergenic
1060903109 9:127279053-127279075 CAGGTGGACCTGAATTTGGGGGG + Intronic
1061002550 9:127910533-127910555 GAAGTGGAGATAATTTTAGGGGG + Intronic
1061755723 9:132811180-132811202 GATGTGGACATCTTTTTGGGAGG - Intronic
1062442451 9:136576837-136576859 GAGGTGGACATGGCTCTTGGGGG - Intergenic
1062635898 9:137491586-137491608 TGGGTAGACATGAATTTGGGGGG - Intronic
1203338893 Un_KI270302v1:1491-1513 GAGCTGAACATGCCTTTGGGTGG + Intergenic
1185874798 X:3693582-3693604 GATGTAGACATATTTTTGGGGGG - Intronic
1185920312 X:4084055-4084077 GAGGTAGGGATGATTTTAGGAGG + Intergenic
1186266709 X:7841392-7841414 GATGTGGATTTCATTTTGGGGGG + Intergenic
1186298336 X:8172015-8172037 GATGTGGACTTCATTTTTGGGGG - Intergenic
1186381911 X:9069811-9069833 GAGGTGGAAATGATGCTTGGAGG - Intronic
1186399460 X:9243225-9243247 CAGGTGGACATCAATTTTGGGGG + Intergenic
1186488449 X:9952457-9952479 GAGAAGGACATGATTTGGGAGGG - Intergenic
1186531449 X:10299832-10299854 GAGGAATACATGATATTGGGGGG + Intergenic
1186769153 X:12800475-12800497 TGGGTGGACATGAGTTTTGGGGG + Intronic
1187468136 X:19543920-19543942 GAGTGGGACAGGATGTTGGGAGG + Intronic
1188166387 X:26869799-26869821 GAGGGGGACATGAGATTTGGGGG - Intergenic
1188517457 X:31002971-31002993 GAGAAGGACATGAGTTTGTGGGG - Intergenic
1188531639 X:31147426-31147448 GAGGTGGGCATCATTTCAGGAGG + Exonic
1189254019 X:39623438-39623460 GAGAAGGACATGAATTTTGGGGG - Intergenic
1189973083 X:46437684-46437706 GAGAAGGACATGAATTTTGGGGG - Intergenic
1190334286 X:49253045-49253067 GAGGGAGACAGGAGTTTGGGAGG + Intronic
1192446188 X:71213324-71213346 GAGCTGGACATCATGGTGGGTGG - Intergenic
1192611886 X:72574937-72574959 GAGGTGGGCAAGATTTTGCTTGG + Intergenic
1192713353 X:73615371-73615393 TGGGTGGACAGGATCTTGGGGGG + Intronic
1194539387 X:95152542-95152564 GAGAAGGACATGGATTTGGGGGG - Intergenic
1194647171 X:96471980-96472002 CAGGTGGATATGAATTTTGGGGG - Intergenic
1195168052 X:102239588-102239610 GAGAAGGACATAAATTTGGGGGG - Intergenic
1195190805 X:102447499-102447521 GAGAAGGACATAAATTTGGGGGG + Intronic
1195297035 X:103489404-103489426 GAGGTGGAACTGAGTCTGGGTGG - Intergenic
1195634927 X:107103198-107103220 GAGGTGGACATGAATTTTAGAGG - Intronic
1195962762 X:110402717-110402739 GAGAAGGACATGCTTTTGGAGGG + Intronic
1196311752 X:114176062-114176084 TTTGTGGACAAGATTTTGGGGGG + Intergenic
1196489443 X:116249324-116249346 GAGGAGGCAATGATTTTTGGAGG - Intergenic
1197265286 X:124362707-124362729 GAGAAGGACATGAGTTTTGGGGG + Intronic
1198104278 X:133447721-133447743 GAGGAGGAGATGGGTTTGGGAGG + Intergenic
1198972958 X:142302120-142302142 GAGAAGGACTTGAGTTTGGGGGG - Intergenic
1199034263 X:143032448-143032470 AAGGAGGAAATGATGTTGGGAGG + Intronic
1199645104 X:149901478-149901500 TAGGTGGAGGGGATTTTGGGGGG - Intergenic
1199876928 X:151939980-151940002 GAGGTGGATATCTTTTGGGGAGG - Intergenic
1199965744 X:152819210-152819232 GATTTGGACATCATTCTGGGGGG - Intergenic
1200244447 X:154515759-154515781 GAAGTGGACATGAGGTTGGCAGG - Exonic
1200776712 Y:7176082-7176104 GAGGAGGTGATGATTTTTGGAGG - Intergenic
1200790035 Y:7291470-7291492 GATGTGGACATATTTTTGGGGGG + Intergenic
1201252069 Y:12069282-12069304 GATGTGGACATGTATTTTGGGGG - Intergenic
1201404421 Y:13635552-13635574 GAGGAGGTGATGATTTTGGGGGG - Intergenic
1201468863 Y:14313074-14313096 GAGGAGGTGATGATTTTGGGGGG - Intergenic
1201495954 Y:14591562-14591584 GAGGAGGTGATGATTTTGGGGGG + Intronic