ID: 1063654821

View in Genome Browser
Species Human (GRCh38)
Location 10:7977726-7977748
Sequence CTTTTTGCTCAGATGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063654817_1063654821 22 Left 1063654817 10:7977681-7977703 CCCAAGTACATAGTATCTGTCAC No data
Right 1063654821 10:7977726-7977748 CTTTTTGCTCAGATGGCACATGG No data
1063654818_1063654821 21 Left 1063654818 10:7977682-7977704 CCAAGTACATAGTATCTGTCACC 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1063654821 10:7977726-7977748 CTTTTTGCTCAGATGGCACATGG No data
1063654819_1063654821 0 Left 1063654819 10:7977703-7977725 CCATGACAAAGAACAAAGATTCT No data
Right 1063654821 10:7977726-7977748 CTTTTTGCTCAGATGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063654821 Original CRISPR CTTTTTGCTCAGATGGCACA TGG Intronic
No off target data available for this crispr