ID: 1063655430

View in Genome Browser
Species Human (GRCh38)
Location 10:7983315-7983337
Sequence CAGAATAAGGGGCAAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063655417_1063655430 28 Left 1063655417 10:7983264-7983286 CCCTGTCAGAAGGGGAAGTGGTA 0: 1
1: 0
2: 0
3: 18
4: 212
Right 1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG No data
1063655424_1063655430 1 Left 1063655424 10:7983291-7983313 CCAGAAGGAAAGGAGGGCTCACA 0: 1
1: 0
2: 2
3: 18
4: 225
Right 1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG No data
1063655418_1063655430 27 Left 1063655418 10:7983265-7983287 CCTGTCAGAAGGGGAAGTGGTAG 0: 1
1: 0
2: 2
3: 15
4: 179
Right 1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063655430 Original CRISPR CAGAATAAGGGGCAAGAGGC AGG Intronic
No off target data available for this crispr