ID: 1063660429

View in Genome Browser
Species Human (GRCh38)
Location 10:8032002-8032024
Sequence CCTATTCAACACCATGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063660422_1063660429 9 Left 1063660422 10:8031970-8031992 CCTACTTGGTAGTCTCAGAGCTT No data
Right 1063660429 10:8032002-8032024 CCTATTCAACACCATGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063660429 Original CRISPR CCTATTCAACACCATGATGA AGG Intergenic
No off target data available for this crispr