ID: 1063661316

View in Genome Browser
Species Human (GRCh38)
Location 10:8036576-8036598
Sequence CTGCTGGAATAGGGGAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063661304_1063661316 6 Left 1063661304 10:8036547-8036569 CCCTGGAAGGGACGCAAAAGTAC No data
Right 1063661316 10:8036576-8036598 CTGCTGGAATAGGGGAAAGGGGG No data
1063661305_1063661316 5 Left 1063661305 10:8036548-8036570 CCTGGAAGGGACGCAAAAGTACC No data
Right 1063661316 10:8036576-8036598 CTGCTGGAATAGGGGAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063661316 Original CRISPR CTGCTGGAATAGGGGAAAGG GGG Intergenic
No off target data available for this crispr