ID: 1063663148

View in Genome Browser
Species Human (GRCh38)
Location 10:8047498-8047520
Sequence CCAACCGTTAAGTAAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063663148_1063663153 11 Left 1063663148 10:8047498-8047520 CCTCTTTTTTACTTAACGGTTGG No data
Right 1063663153 10:8047532-8047554 AGAGGCTTTGTAGCCTCCAAGGG No data
1063663148_1063663152 10 Left 1063663148 10:8047498-8047520 CCTCTTTTTTACTTAACGGTTGG No data
Right 1063663152 10:8047531-8047553 GAGAGGCTTTGTAGCCTCCAAGG No data
1063663148_1063663150 -7 Left 1063663148 10:8047498-8047520 CCTCTTTTTTACTTAACGGTTGG No data
Right 1063663150 10:8047514-8047536 CGGTTGGAATAACCAGAGAGAGG No data
1063663148_1063663154 23 Left 1063663148 10:8047498-8047520 CCTCTTTTTTACTTAACGGTTGG No data
Right 1063663154 10:8047544-8047566 GCCTCCAAGGGAGCAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063663148 Original CRISPR CCAACCGTTAAGTAAAAAAG AGG (reversed) Intergenic
No off target data available for this crispr