ID: 1063663184

View in Genome Browser
Species Human (GRCh38)
Location 10:8047669-8047691
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063663184_1063663190 3 Left 1063663184 10:8047669-8047691 CCACCGGGTATCCGTCGCTGCCG No data
Right 1063663190 10:8047695-8047717 TGCTGGCGTTAGTGAAGAACAGG No data
1063663184_1063663191 16 Left 1063663184 10:8047669-8047691 CCACCGGGTATCCGTCGCTGCCG No data
Right 1063663191 10:8047708-8047730 GAAGAACAGGCACATGCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063663184 Original CRISPR CGGCAGCGACGGATACCCGG TGG (reversed) Intergenic
No off target data available for this crispr