ID: 1063663188

View in Genome Browser
Species Human (GRCh38)
Location 10:8047680-8047702
Sequence CGCCAGCAGACCGGCAGCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063663188_1063663190 -8 Left 1063663188 10:8047680-8047702 CCGTCGCTGCCGGTCTGCTGGCG No data
Right 1063663190 10:8047695-8047717 TGCTGGCGTTAGTGAAGAACAGG No data
1063663188_1063663191 5 Left 1063663188 10:8047680-8047702 CCGTCGCTGCCGGTCTGCTGGCG No data
Right 1063663191 10:8047708-8047730 GAAGAACAGGCACATGCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063663188 Original CRISPR CGCCAGCAGACCGGCAGCGA CGG (reversed) Intergenic
No off target data available for this crispr