ID: 1063663189

View in Genome Browser
Species Human (GRCh38)
Location 10:8047689-8047711
Sequence CTTCACTAACGCCAGCAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063663189_1063663192 30 Left 1063663189 10:8047689-8047711 CCGGTCTGCTGGCGTTAGTGAAG No data
Right 1063663192 10:8047742-8047764 TTTTATATAACAAATTGCTTAGG No data
1063663189_1063663191 -4 Left 1063663189 10:8047689-8047711 CCGGTCTGCTGGCGTTAGTGAAG No data
Right 1063663191 10:8047708-8047730 GAAGAACAGGCACATGCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063663189 Original CRISPR CTTCACTAACGCCAGCAGAC CGG (reversed) Intergenic
No off target data available for this crispr