ID: 1063663190

View in Genome Browser
Species Human (GRCh38)
Location 10:8047695-8047717
Sequence TGCTGGCGTTAGTGAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063663186_1063663190 0 Left 1063663186 10:8047672-8047694 CCGGGTATCCGTCGCTGCCGGTC No data
Right 1063663190 10:8047695-8047717 TGCTGGCGTTAGTGAAGAACAGG No data
1063663188_1063663190 -8 Left 1063663188 10:8047680-8047702 CCGTCGCTGCCGGTCTGCTGGCG No data
Right 1063663190 10:8047695-8047717 TGCTGGCGTTAGTGAAGAACAGG No data
1063663184_1063663190 3 Left 1063663184 10:8047669-8047691 CCACCGGGTATCCGTCGCTGCCG No data
Right 1063663190 10:8047695-8047717 TGCTGGCGTTAGTGAAGAACAGG No data
1063663182_1063663190 15 Left 1063663182 10:8047657-8047679 CCCGGCTGAGGTCCACCGGGTAT No data
Right 1063663190 10:8047695-8047717 TGCTGGCGTTAGTGAAGAACAGG No data
1063663183_1063663190 14 Left 1063663183 10:8047658-8047680 CCGGCTGAGGTCCACCGGGTATC No data
Right 1063663190 10:8047695-8047717 TGCTGGCGTTAGTGAAGAACAGG No data
1063663179_1063663190 24 Left 1063663179 10:8047648-8047670 CCGAGGCGTCCCGGCTGAGGTCC No data
Right 1063663190 10:8047695-8047717 TGCTGGCGTTAGTGAAGAACAGG No data
1063663178_1063663190 25 Left 1063663178 10:8047647-8047669 CCCGAGGCGTCCCGGCTGAGGTC No data
Right 1063663190 10:8047695-8047717 TGCTGGCGTTAGTGAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063663190 Original CRISPR TGCTGGCGTTAGTGAAGAAC AGG Intergenic
No off target data available for this crispr