ID: 1063663191

View in Genome Browser
Species Human (GRCh38)
Location 10:8047708-8047730
Sequence GAAGAACAGGCACATGCGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063663183_1063663191 27 Left 1063663183 10:8047658-8047680 CCGGCTGAGGTCCACCGGGTATC No data
Right 1063663191 10:8047708-8047730 GAAGAACAGGCACATGCGTCTGG No data
1063663189_1063663191 -4 Left 1063663189 10:8047689-8047711 CCGGTCTGCTGGCGTTAGTGAAG No data
Right 1063663191 10:8047708-8047730 GAAGAACAGGCACATGCGTCTGG No data
1063663184_1063663191 16 Left 1063663184 10:8047669-8047691 CCACCGGGTATCCGTCGCTGCCG No data
Right 1063663191 10:8047708-8047730 GAAGAACAGGCACATGCGTCTGG No data
1063663182_1063663191 28 Left 1063663182 10:8047657-8047679 CCCGGCTGAGGTCCACCGGGTAT No data
Right 1063663191 10:8047708-8047730 GAAGAACAGGCACATGCGTCTGG No data
1063663188_1063663191 5 Left 1063663188 10:8047680-8047702 CCGTCGCTGCCGGTCTGCTGGCG No data
Right 1063663191 10:8047708-8047730 GAAGAACAGGCACATGCGTCTGG No data
1063663186_1063663191 13 Left 1063663186 10:8047672-8047694 CCGGGTATCCGTCGCTGCCGGTC No data
Right 1063663191 10:8047708-8047730 GAAGAACAGGCACATGCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063663191 Original CRISPR GAAGAACAGGCACATGCGTC TGG Intergenic
No off target data available for this crispr