ID: 1063665406

View in Genome Browser
Species Human (GRCh38)
Location 10:8057834-8057856
Sequence CTGTGAGTGAGGAGGCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 355}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063665406_1063665411 -2 Left 1063665406 10:8057834-8057856 CCTTCAGGCCTCCTCACTCACAG 0: 1
1: 0
2: 1
3: 26
4: 355
Right 1063665411 10:8057855-8057877 AGCCGGCTCTCTTATCAGGCTGG No data
1063665406_1063665417 29 Left 1063665406 10:8057834-8057856 CCTTCAGGCCTCCTCACTCACAG 0: 1
1: 0
2: 1
3: 26
4: 355
Right 1063665417 10:8057886-8057908 AAGTCCGAGTCAGGGAACTCAGG No data
1063665406_1063665415 20 Left 1063665406 10:8057834-8057856 CCTTCAGGCCTCCTCACTCACAG 0: 1
1: 0
2: 1
3: 26
4: 355
Right 1063665415 10:8057877-8057899 GCTGGGATTAAGTCCGAGTCAGG No data
1063665406_1063665418 30 Left 1063665406 10:8057834-8057856 CCTTCAGGCCTCCTCACTCACAG 0: 1
1: 0
2: 1
3: 26
4: 355
Right 1063665418 10:8057887-8057909 AGTCCGAGTCAGGGAACTCAGGG No data
1063665406_1063665413 2 Left 1063665406 10:8057834-8057856 CCTTCAGGCCTCCTCACTCACAG 0: 1
1: 0
2: 1
3: 26
4: 355
Right 1063665413 10:8057859-8057881 GGCTCTCTTATCAGGCTGGCTGG No data
1063665406_1063665410 -6 Left 1063665406 10:8057834-8057856 CCTTCAGGCCTCCTCACTCACAG 0: 1
1: 0
2: 1
3: 26
4: 355
Right 1063665410 10:8057851-8057873 TCACAGCCGGCTCTCTTATCAGG No data
1063665406_1063665414 3 Left 1063665406 10:8057834-8057856 CCTTCAGGCCTCCTCACTCACAG 0: 1
1: 0
2: 1
3: 26
4: 355
Right 1063665414 10:8057860-8057882 GCTCTCTTATCAGGCTGGCTGGG No data
1063665406_1063665416 21 Left 1063665406 10:8057834-8057856 CCTTCAGGCCTCCTCACTCACAG 0: 1
1: 0
2: 1
3: 26
4: 355
Right 1063665416 10:8057878-8057900 CTGGGATTAAGTCCGAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063665406 Original CRISPR CTGTGAGTGAGGAGGCCTGA AGG (reversed) Intronic
900146629 1:1161505-1161527 CAGTGAGTGAGGCGGCGTGCGGG + Intergenic
901428200 1:9196925-9196947 ATCTGAGTCAGGATGCCTGATGG + Intergenic
901574471 1:10189764-10189786 ATGTGAGTGAGGAAGCCCTAAGG - Intergenic
901886842 1:12229724-12229746 CTGTGGGTGAGTGGGCCAGACGG + Intergenic
903019854 1:20386419-20386441 GAGAGAGTGAGGGGGCCTGAGGG - Intergenic
903063759 1:20687045-20687067 CAGTGAGTGTCCAGGCCTGACGG - Intronic
903578552 1:24354129-24354151 CTGTGAGTGTGGGGGCCAGCAGG + Intronic
903872626 1:26447612-26447634 CTGTGAGAGAGATGGCCTGGGGG + Exonic
904383099 1:30124659-30124681 CTGGGAGTGGCGAGGCCTGGTGG + Intergenic
904702570 1:32366609-32366631 CTGGGAGTGAGGGAGCCAGAGGG - Exonic
904775987 1:32906865-32906887 CAGTGAGAGATGAGGCCTGTAGG + Intergenic
906104780 1:43285322-43285344 CTGTGAGTTCAGAGGCCTGTTGG - Intronic
906108649 1:43309162-43309184 CTGTGAAGCAGGCGGCCTGAGGG - Intronic
906162992 1:43664488-43664510 AAGTGAGTGATGAGGCCGGAGGG + Intronic
906299738 1:44673391-44673413 CAGTGAGACAGGAGGCGTGAAGG + Intronic
906647539 1:47486502-47486524 GTGTGAGTGAGGAGGAGGGAGGG + Intergenic
908961384 1:69700512-69700534 CTGTGAGGAAGGAGACATGAAGG - Intronic
910516548 1:88067863-88067885 CTGTGAGTGAGAGGTGCTGAAGG + Intergenic
910728727 1:90366993-90367015 CTGTGAGGGTGGAGTCCTCATGG - Intergenic
911228791 1:95337618-95337640 CTGTGATTGATGAGGTCTGCCGG + Intergenic
911317336 1:96370926-96370948 CTGGGAGTGGGGATGCCTGTGGG + Intergenic
912834653 1:112985573-112985595 CTGTGAGAGTGGAGCCCTCAGGG + Intergenic
913086119 1:115438669-115438691 GTGTGAGTGAGCAAGCCTCAAGG - Intergenic
916502896 1:165401665-165401687 CTGTGAATGAGGGGAGCTGAGGG - Intronic
918299575 1:183190501-183190523 CTGTGTGTGATGAGGTCTGGTGG - Intronic
919942766 1:202299718-202299740 CTGTGAGTGAGACAGCATGAAGG + Intronic
919973235 1:202594198-202594220 CTGCTAGTGAGGAGCCTTGAGGG - Exonic
923053155 1:230403106-230403128 CTGTTAGAGAAGAGGCCTGGAGG - Intronic
923470441 1:234285754-234285776 TTGTGGGTGAGGATTCCTGAGGG + Intronic
924037568 1:239953050-239953072 CGGTGTGTGAGGAGGCCTGGGGG - Intergenic
924043890 1:240009241-240009263 CTGAGGGTGAGGAGGCCTGGAGG + Intergenic
924090156 1:240493212-240493234 CGGTGAGCGAGGAGGGCTGCCGG - Exonic
1063665406 10:8057834-8057856 CTGTGAGTGAGGAGGCCTGAAGG - Intronic
1065176536 10:23081730-23081752 CTGCCGGTGAGGAGGTCTGAGGG + Intergenic
1065325763 10:24549577-24549599 GTGAGAGTGAGCAAGCCTGAGGG - Intergenic
1065414112 10:25466023-25466045 CTGTGAGTTGGTGGGCCTGATGG - Intronic
1070900337 10:80022806-80022828 CTGTCAGTGTGGATGCCAGAGGG + Intergenic
1071173953 10:82901498-82901520 CTGAGAATGAGGAGGCCTCTGGG - Intronic
1072273460 10:93800069-93800091 CTGTGAGTGAAGATGCCTCTGGG + Intergenic
1075589075 10:123678479-123678501 CTTGGGGTCAGGAGGCCTGAAGG + Intronic
1076716497 10:132366854-132366876 ATGGGAGAGAGGAGGCATGAGGG + Intronic
1077120346 11:904603-904625 CTGTGAGCCAGGAGGCTCGAGGG - Intronic
1077184121 11:1228837-1228859 CTGGGGGTGGGGAGGCCTGGGGG + Intronic
1077753067 11:4994827-4994849 CTGTGAGTGGTGAGGCTTGAAGG - Intergenic
1077938129 11:6812485-6812507 CTGGGAGTGGGGAGGTCTCAGGG + Intergenic
1081154789 11:39677001-39677023 CTGTGAGGCAGGAAGCCTGCTGG - Intergenic
1081412528 11:42776580-42776602 CTGTGACTGTGGGGTCCTGAAGG + Intergenic
1083140118 11:60714740-60714762 CTTTGGGTGTGGAGACCTGAGGG - Intronic
1083153131 11:60806080-60806102 CTGTGTGAGAAGAGGCCTGCAGG + Intergenic
1083196343 11:61090833-61090855 CTGTGGAAGAGGAGGCCTGGCGG + Intergenic
1083259921 11:61517372-61517394 CTGTGAGTGAGTCGGGCAGAAGG + Intronic
1084942074 11:72618278-72618300 CTGGGAGTGGGGAGGCTGGAGGG - Intronic
1085340649 11:75729007-75729029 CTGGGAGGGAGGAGGCCAAAGGG + Intronic
1085442851 11:76579281-76579303 CTGGGAGGGAAGAGGCCGGAAGG + Intergenic
1085554896 11:77411359-77411381 CTGGGAGGGAGGAGACCTGGGGG - Intronic
1086184955 11:84002417-84002439 CTGTGGGAGAGGAGCCCTCATGG - Intronic
1088217078 11:107522952-107522974 CTGTGTGAGAGGGGGCCCGAAGG - Intronic
1090397326 11:126427647-126427669 CTGGCACTGAGGAGCCCTGATGG + Intronic
1090403122 11:126461465-126461487 TTGTGAATGAGGATGCCAGAAGG + Intronic
1090408826 11:126493721-126493743 CTGTGGGTGAGGGGGGCTGTAGG - Intronic
1090599871 11:128358917-128358939 CTGTGAGTGTGAAGCGCTGAGGG + Intergenic
1091311840 11:134580454-134580476 CTGTGGGTGGGGAGCTCTGAGGG + Intergenic
1091848049 12:3672775-3672797 CTGTGAGTGAGGAGGACTCTGGG + Intronic
1093238241 12:16638889-16638911 CTGGGATTGAGGAGGTCTGTGGG + Intergenic
1093366512 12:18306150-18306172 ATTTGAGTGAGGAGGCATTAGGG + Intronic
1094102560 12:26779528-26779550 CTGGGAGAGAGAAGGCCTGGTGG - Intronic
1094372365 12:29751805-29751827 CTGGCAGTGAGGAGGGCTGGGGG + Exonic
1096533048 12:52253919-52253941 CTGGGCTTGAGGAGTCCTGAGGG - Intronic
1096581669 12:52589653-52589675 CTTTGATGGAGGAGGCCAGAAGG + Intronic
1096633310 12:52943547-52943569 TTGTGGGTGAGGTGGCCTAAGGG - Intronic
1096749691 12:53751155-53751177 CTGTGCGTGCGGAGGCCTGTGGG - Intergenic
1096791215 12:54046396-54046418 CTGTGGGGGAGGGGGCCTGGGGG + Intronic
1097169585 12:57105340-57105362 CTGGGAGTGAGGAGGACACAAGG + Intronic
1097222708 12:57460238-57460260 CAGTGGGGGAGGGGGCCTGAGGG + Intronic
1097292977 12:57935124-57935146 GTATGAGGGAGGAGGCCTAATGG - Intergenic
1099026466 12:77470156-77470178 CTATTTCTGAGGAGGCCTGAAGG - Intergenic
1101472854 12:105014954-105014976 CTGTGAGTGGGCAGAGCTGATGG + Intronic
1102069218 12:110003520-110003542 CTGAGAGTGAAGAGGAGTGAGGG + Intronic
1102352028 12:112200091-112200113 CTGTGATTTGGGAGGACTGATGG - Intronic
1102622810 12:114210181-114210203 ATGGGAGTGAGGATGCATGAGGG + Intergenic
1104064294 12:125294045-125294067 CTGTGAGTGAGAAAGCCTCCAGG + Intronic
1105053795 12:133079298-133079320 CTGTGAGTTAGAATGCCTAACGG - Intergenic
1109122899 13:58481102-58481124 CTTTGAGTTAGGAAGCCTGGAGG - Intergenic
1112183641 13:97108446-97108468 CTCTGACTAAGGAGGCTTGATGG + Intergenic
1112328863 13:98462062-98462084 CTGTGAGGGAGGAGGCGGGGGGG - Intronic
1115422533 14:33213137-33213159 CAGTGAGTGAAGAGGCCTGATGG - Intronic
1115909510 14:38240099-38240121 CTGTGAGGCAGGGGGCCTGATGG + Intergenic
1116855296 14:49946691-49946713 TTCTGAGTGAGGAGGCCTGTGGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117377186 14:55127671-55127693 CTTTGAGTCATGAGGCCTCATGG - Intronic
1117451479 14:55854261-55854283 CGGTGAATGAGAATGCCTGAAGG - Intergenic
1118682640 14:68259252-68259274 CTGTGAGTGAGGACACAGGAAGG + Intronic
1120253178 14:82085227-82085249 TTGTGAGTAGGGATGCCTGAGGG + Intergenic
1121057728 14:90874290-90874312 CAGTGTGTTAGCAGGCCTGAGGG + Intronic
1121117561 14:91354388-91354410 CTGTGAGGGAGGATGCTGGATGG - Intronic
1122138782 14:99649967-99649989 CTGCCAGTGAGCAGGCCAGATGG - Intronic
1122440273 14:101727029-101727051 TTGGGAGTAAGGAGGCCTGGAGG - Intergenic
1122597613 14:102904034-102904056 CTGTGGGTGCTGAGGCCGGAGGG + Intronic
1122639812 14:103152416-103152438 CCGTGAGTGAGATGGCCTGGCGG + Intergenic
1122659978 14:103288448-103288470 CTGTGAGTCAGCAAGACTGACGG - Intergenic
1122915408 14:104856079-104856101 CAGGGAGAGGGGAGGCCTGAGGG + Intergenic
1123012503 14:105356181-105356203 CTGGGAGACAGGAGGCCTGCAGG - Intronic
1126695252 15:51320496-51320518 AGGTGAGTGAGGAGACCAGATGG + Intronic
1128475369 15:67992794-67992816 ATTTGGGTGAGGAGGGCTGAAGG - Intergenic
1129233652 15:74210663-74210685 CTGTGAGTAAGGAGCTGTGAAGG + Intronic
1129604593 15:77018699-77018721 CTGTGAGGGAGGAAGCCCGAGGG + Intronic
1132594745 16:743598-743620 GTGAGAGTGAGGAGGGCTGTTGG + Intronic
1132834745 16:1947099-1947121 CTGTGAGTGAGAGGGGCTGGTGG + Intronic
1133220846 16:4318594-4318616 CTGAGAGTGAACAGGCCGGAGGG + Intronic
1134520779 16:14918372-14918394 CTGTGAGTGCGGCGGGCGGATGG + Intronic
1134550796 16:15137601-15137623 CTGTGAGTGCGGCGGGCGGATGG - Intronic
1134708451 16:16317023-16317045 CTGTGAGTGCGGCGGGCGGATGG + Intergenic
1134715666 16:16357056-16357078 CTGTGAGTGCGGCGGGCGGATGG + Intergenic
1134951151 16:18351622-18351644 CTGTGAGTGCGGCGGGCGGATGG - Intergenic
1134959091 16:18395103-18395125 CTGTGAGTGCGGCGGGCGGATGG - Intergenic
1135101267 16:19608134-19608156 CTGAGATTTAGGAGGGCTGATGG + Intronic
1135382942 16:22008834-22008856 CTGAGAGTGAGGCAGCCTGCGGG + Intronic
1136687279 16:32002856-32002878 CTGGGAGTGGGGAGGCAGGAGGG + Intergenic
1136881890 16:33907382-33907404 CTGGGAGTGGGGAGGCAGGAGGG - Intergenic
1137379517 16:47984325-47984347 CTATGAGTCAGGAAGTCTGATGG + Intergenic
1137538230 16:49343546-49343568 CTGTGAGTGAGGCAGCTTGGAGG + Intergenic
1137859811 16:51835013-51835035 CTGTCACTGAGGCTGCCTGAGGG - Intergenic
1140454138 16:75094992-75095014 CTGGGAGTGAGGAGGCTGCAGGG - Intronic
1140781989 16:78305340-78305362 TTGTGAGCAAGGAGGCCGGAGGG - Intronic
1141473083 16:84252615-84252637 CTGTGAGATGGGAGGCCTGGAGG + Intergenic
1141999506 16:87656128-87656150 CTGTGAGCCAGGAGCCCTGAGGG + Intronic
1142111304 16:88333075-88333097 CTTAGAGGGAGGAGGCCTGCTGG + Intergenic
1203090121 16_KI270728v1_random:1208064-1208086 CTGGGAGTGGGGAGGCAGGAGGG + Intergenic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143096575 17:4481415-4481437 CAGGGAGGGAGGAGGCCTTAGGG + Intronic
1143315695 17:6031771-6031793 CTTTTGGTGAGGACGCCTGAAGG - Intronic
1143508605 17:7383349-7383371 CTGGGAATGAGGTGGCTTGAGGG + Intronic
1143985154 17:10906922-10906944 CTGAGAGGGAAGAGGCCTCAGGG + Intergenic
1144997009 17:19276933-19276955 GTTTGAGTGAGGAGCCCAGAAGG + Intronic
1146970516 17:37068065-37068087 CTGTGTCTGAGGACGCCTGGCGG - Intergenic
1147333892 17:39715544-39715566 CTGAGAAAGAGGGGGCCTGATGG + Intronic
1147605665 17:41772462-41772484 CTGGGAGAGAGGGGGCCTTAGGG - Intronic
1147968191 17:44205542-44205564 CTGGGGGTGGGGAGGCCTGGGGG - Exonic
1149606727 17:57930351-57930373 CTGGCTGTGAGGAGGCCAGAAGG + Intronic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1153523974 18:5977817-5977839 CAGAGGGTGATGAGGCCTGAGGG - Intronic
1155517294 18:26636665-26636687 ATGTGAGTGTGAAGTCCTGAGGG - Intronic
1155533319 18:26789995-26790017 CTTTGTGTGAGGAGGCATGAAGG + Intergenic
1155997363 18:32344156-32344178 CTGGGAGTGAGGAGGCGGGGAGG - Intronic
1156108664 18:33696626-33696648 CTCTGAGTGAGGGGGGCTGGAGG + Intronic
1156629647 18:38951595-38951617 CTGTTAGTGAGGGGGCTGGAAGG - Intergenic
1159344564 18:67183547-67183569 CTGTAAGAGAGGAAGACTGATGG + Intergenic
1160309178 18:77772807-77772829 CTGTGAGAGAGGAGCCGTGGAGG + Intergenic
1160400579 18:78608023-78608045 CTGCGAGGGAGGAGGCCTCGTGG - Intergenic
1160420479 18:78740495-78740517 CTGTGGGTCAGGTGGCGTGAGGG + Intergenic
1160738776 19:676525-676547 CGGTGAGTGGGGCGGCCAGAGGG + Exonic
1162043753 19:7985551-7985573 CCCTGAGACAGGAGGCCTGAGGG + Intronic
1162433837 19:10644818-10644840 CTGAGAGAGGGGAGGCCTGGGGG - Intergenic
1162468854 19:10860013-10860035 TGGTGTGTGATGAGGCCTGATGG - Intronic
1162875286 19:13616841-13616863 GAGTGAGTGAGGGGGCCAGAAGG + Intronic
1162919987 19:13895330-13895352 CTGTCAGTGGGGAGACCTGCCGG + Intronic
1163124720 19:15238722-15238744 CCGTGAGTCTGGAGGCCTGGTGG - Exonic
1163747435 19:19056753-19056775 CTGGGAGTGAGGAGGCGAGGAGG - Intronic
1164378610 19:27711737-27711759 CTGTGGGAGAGGAAGGCTGAGGG + Intergenic
1164807870 19:31130761-31130783 TTGTGAGGGAGGAGCCCTCATGG + Intergenic
1164835466 19:31352519-31352541 CTGTGTGTGACATGGCCTGATGG + Intergenic
1165306085 19:35003774-35003796 GTGTGAGTGAGGTGGCCAGTGGG - Intronic
1167153872 19:47726219-47726241 GTGCGAGTGAGTAGTCCTGAGGG + Exonic
1167449136 19:49556802-49556824 CTGTGCGTGAGGAGGACGGTGGG + Intronic
1167599804 19:50448016-50448038 GAGGGAGCGAGGAGGCCTGAGGG - Intronic
1167853494 19:52219863-52219885 TGGTGAGTGAGGAGGCCTGGGGG + Exonic
925032884 2:665113-665135 CTGTGAGTGAGTTGGGCTTAGGG + Intergenic
925388118 2:3477109-3477131 CTGTGGCAGAGGAGGCCTGGGGG - Intronic
925420859 2:3710354-3710376 CTGTCAGAGAGGAGGAATGAGGG - Intronic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
927635681 2:24814603-24814625 GTGTGAGTGATGAGGGCAGAGGG - Intronic
929081854 2:38129326-38129348 CAGTGAGTGAGGAAGCTAGACGG - Intergenic
931976264 2:67647068-67647090 CTGTGTGAGAAGGGGCCTGAAGG + Intergenic
932574208 2:72954009-72954031 CTGTAAGTGGGGAGGCAGGAAGG + Intronic
933792421 2:85893727-85893749 CTGTGAGGCAGGAGGGGTGAGGG + Intergenic
935127983 2:100240719-100240741 GTGTGAGGGAGGATGCCTGCGGG - Intergenic
935645303 2:105329604-105329626 CGGTGAGTGAGGAGGGCGGCGGG - Exonic
937449011 2:121985040-121985062 CTGTGAGGGTGGAGCCCTCATGG + Intergenic
938117706 2:128613111-128613133 TTCTGATTGATGAGGCCTGAGGG + Intergenic
938185633 2:129229440-129229462 CTGTGAGTGAGCAAGCCTTTTGG + Intergenic
938186272 2:129234703-129234725 CTGTGAGTGAGCAAGCCTTTTGG + Intergenic
939097467 2:137851020-137851042 GTGTGTGTGAGGAGGCAGGACGG + Intergenic
940203209 2:151174182-151174204 CAGTGAGAGCTGAGGCCTGACGG - Intergenic
941439132 2:165511655-165511677 CTGAGAGTGAGGAGGTGGGAAGG + Intronic
944214116 2:197236841-197236863 CAGTGAGGGAGAAGGTCTGAAGG + Intronic
944496840 2:200315718-200315740 CTGTGGATGAGTTGGCCTGAAGG + Intronic
945124401 2:206492295-206492317 GAGAGAGTGTGGAGGCCTGAAGG + Intronic
945216820 2:207442970-207442992 GTGTGAGAGAGGAGGCCCAAGGG + Intergenic
945743424 2:213691027-213691049 CAGTGACGGAGGAGCCCTGAAGG + Intronic
946148657 2:217749425-217749447 CTGTGACTCAGGGGTCCTGAAGG - Intronic
946570026 2:221014270-221014292 CAGTGAGTCAGGAGTGCTGATGG - Intergenic
946626004 2:221613028-221613050 CAGTGAGAGAGGAGGCCAGCAGG + Intergenic
946784217 2:223225437-223225459 CTGTGAGTGAGATGGTCAGATGG + Intergenic
947441946 2:230131223-230131245 CTGAGAGGGAGGAGGCCTTTGGG - Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169104635 20:2984220-2984242 ATGTGAGTGAGGTGGACAGATGG - Intronic
1169234802 20:3922425-3922447 CTGTGTCTCAGGAGGGCTGAGGG + Intronic
1169535722 20:6537880-6537902 CTGTGAGTGAGCAGGAATGAGGG + Intergenic
1169735812 20:8836386-8836408 CTGAGAATGAGGAGAGCTGATGG + Intronic
1170048138 20:12109461-12109483 CTCTGAGTCAAGATGCCTGAGGG + Intergenic
1170857867 20:20074092-20074114 TTGTGAGTAAGGAGGACAGAAGG + Intronic
1171387690 20:24781180-24781202 AGGTGAGGGAGGAGGACTGAAGG - Intergenic
1173106450 20:40141272-40141294 GTGAGAGTGAAGAGGCCGGATGG + Intergenic
1173627802 20:44486467-44486489 CTGTCATTGAGGAGGCCATAAGG + Intronic
1173923346 20:46762233-46762255 CTTTGAGTGTTGAGGCCAGAAGG + Intergenic
1173945843 20:46950394-46950416 CTGTGAGTTTGGAGGTCTCATGG + Intronic
1174772718 20:53316185-53316207 TTGTGAGTGGGGATGACTGAGGG - Intronic
1175186818 20:57184380-57184402 CAGTGAGTGAGGGGGCCCAATGG + Intronic
1176266237 20:64210889-64210911 CTGACAGTGTGGAGGCCTCATGG - Intronic
1177440182 21:21112680-21112702 TTGTGGGTGATAAGGCCTGATGG - Intronic
1177605486 21:23372033-23372055 CTGAGAGTCAGGAGAGCTGATGG - Intergenic
1181968436 22:26672523-26672545 ACGTGAGTGTGGAGGCCTGTTGG + Intergenic
1182021684 22:27086903-27086925 CTGTGAGAAAGGAGGCGTGCCGG + Intergenic
1182454499 22:30441243-30441265 CAGTGAGTCAGGAGTGCTGATGG + Intergenic
1183335903 22:37245667-37245689 CTGTGAGGGAGGAAGCCCCAGGG - Intergenic
1183494882 22:38137406-38137428 CTGAGACTGAGGATGCCTGGGGG - Intronic
1183724804 22:39582602-39582624 CTGAGAGTGGGGATCCCTGAAGG + Intronic
1183872203 22:40748493-40748515 CTGTGTAAGAGGGGGCCTGAAGG - Intergenic
1184532711 22:45066638-45066660 CTGTGAGTTGGGAAGCCTGGGGG - Intergenic
1184761644 22:46548097-46548119 CAATGAGTCAGGAGGCCTGGTGG + Intergenic
1184784342 22:46664524-46664546 CTGTGAGCCATGAGTCCTGAGGG + Intronic
949399554 3:3651749-3651771 CAGTGAGTGAGGAGACATGGAGG - Intergenic
950121028 3:10482670-10482692 CTGTGACTGGCGAGGCCTCAGGG - Intronic
950141815 3:10620924-10620946 CTGTGAGTGAGGAGGACACAGGG - Intronic
950453820 3:13080650-13080672 CTGTGGGTAAGGATGCCTGCTGG - Intergenic
950566796 3:13774103-13774125 CTGTGAGTGCGCAGGGGTGAAGG + Intergenic
952098546 3:29984828-29984850 CTGCCAGTCAGGAGGCATGAGGG + Intronic
952731682 3:36643492-36643514 CGGTGAGAGAGGAAGCATGAGGG + Intergenic
953022807 3:39126688-39126710 CTGGGAGTGGGCAGGCCTGTAGG - Intronic
953391350 3:42535699-42535721 CAGTGAGTGGGGAGGGATGAGGG + Intronic
954758932 3:52860353-52860375 CTGTCAATGAGGAGGTATGAAGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957293437 3:78306693-78306715 CTCTATGTGTGGAGGCCTGATGG + Intergenic
957744079 3:84316132-84316154 CTGAGAATCAGGAGCCCTGAGGG + Intergenic
958862236 3:99457985-99458007 CTGTGGGTGAGGAGGTTTGCAGG + Intergenic
959105854 3:102063672-102063694 CTGAGAGGGAGAAGGCCTGCCGG - Intergenic
959906246 3:111714011-111714033 CTCTGAGTGAGCGGGCCTCACGG + Exonic
961626101 3:128264802-128264824 CTGCCAGCGAGGAGGCCAGAAGG - Intronic
962108505 3:132417663-132417685 GTGAGGGTGAGGAGGCCGGAGGG + Exonic
962676640 3:137763027-137763049 CAGGGAATGAGGAGGCCGGAAGG - Intergenic
963260137 3:143184162-143184184 CTGGGAGTGAAGAGGCAGGAGGG - Intergenic
964123379 3:153209845-153209867 CTGCGACTCAGGAGGCCTGCAGG - Intergenic
964268530 3:154929529-154929551 CTGTGAGCCAGGAGGCAAGAGGG + Intergenic
968861466 4:3174489-3174511 CTGCGAGTGAGGAGACTTGATGG + Intronic
969346994 4:6575960-6575982 CAGGGAGTCAGGAGGCATGAGGG - Intronic
974410680 4:61538356-61538378 CTGAGAGTGTGGAGGTCTTAGGG + Intronic
976198323 4:82555548-82555570 CTGTGTAAGAGGAGGCCTGATGG - Intronic
976751925 4:88457568-88457590 CTGTGAGGGGTGAGGGCTGAGGG + Intronic
978384276 4:108165879-108165901 GTGGGCATGAGGAGGCCTGAGGG - Intronic
980299425 4:130968113-130968135 CTGTGAGTAAGAATCCCTGAAGG - Intergenic
981901404 4:149869456-149869478 CTGTGACTGAGGAGTTCTCAAGG + Intergenic
983464734 4:168073261-168073283 CAGTGAATAGGGAGGCCTGAGGG + Intergenic
985500828 5:243953-243975 CAGTGAGTGAGGGTGCCAGATGG + Intronic
985624868 5:980083-980105 CGGTGAGCGAGGAGGCCCCACGG - Intronic
985903449 5:2814591-2814613 CTCTGAGGGAGGAGGAGTGAAGG + Intergenic
986304940 5:6507956-6507978 CTGTGAGTGTCGAGGCCCCAAGG - Intergenic
991008283 5:61854034-61854056 CTGGGTGTGTGGAGGCCTGAGGG - Intergenic
991907592 5:71527330-71527352 CTGAGAGTGACCAGGCCAGACGG - Intronic
992950875 5:81857043-81857065 CTCTGCCAGAGGAGGCCTGATGG - Intergenic
995597067 5:113759088-113759110 GAGTGAGTGAGGAGGCATGAGGG + Intergenic
998128754 5:139640661-139640683 CTGTGTGTGGGGAGGAATGAGGG + Intergenic
998529247 5:142869936-142869958 CTCTGAGTGAGGGGACCAGATGG - Intronic
1001571481 5:172733185-172733207 CTGGGAGAGAGGAGGCAGGATGG + Intergenic
1001773220 5:174311295-174311317 CTGTGTGTGAGGAGGCCCGGGGG + Intergenic
1003436318 6:6091731-6091753 GTGTGAGTGAGGAGCTCAGATGG + Intergenic
1006648519 6:35532319-35532341 CTGGGAGGGAGGGGGACTGAAGG - Intergenic
1007282111 6:40720440-40720462 GTGGGGGTGGGGAGGCCTGAGGG - Intergenic
1007356306 6:41320163-41320185 CTGTGAGTGAAGGAGCCTGGTGG + Intergenic
1007704029 6:43780411-43780433 CTGTGAGTGTGGAGACCTTTGGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1009801342 6:68540527-68540549 TCGTGAGGGAGGAGCCCTGATGG + Intergenic
1010185674 6:73140874-73140896 CTTTGAATGAAGATGCCTGAGGG - Intronic
1010327231 6:74578383-74578405 ATGTGAGTGAGTAAGCCTGTTGG + Intergenic
1010377926 6:75194720-75194742 CTGTGCTTTAGGAAGCCTGAGGG - Intronic
1010753862 6:79644388-79644410 CTGGTAGGGAGGAGGCCTGCAGG + Intronic
1012360227 6:98368506-98368528 TTGAGAGAGTGGAGGCCTGAAGG + Intergenic
1013169726 6:107625658-107625680 CAGGGAGTGAGGAGGCTGGAAGG + Intronic
1013327955 6:109067179-109067201 TTGTGAGTGAGGAGGCATTGGGG - Intronic
1013461429 6:110378488-110378510 CGGTGAGTGAGGGGGCCCAAGGG - Intergenic
1013551216 6:111209600-111209622 CTGTGGGTTAAGAGGCCTGTGGG + Intronic
1013551220 6:111209616-111209638 CTGTGGGTTAGGAAGCCTGTGGG + Intronic
1014717106 6:124879450-124879472 CTGTCAGTCTGAAGGCCTGAGGG - Intergenic
1016013780 6:139164164-139164186 CTGGAAGTAAGGAGGCCAGAGGG - Intronic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016633643 6:146261112-146261134 CTGTGAGTGAGGAGTCAGCAAGG + Intronic
1017644161 6:156523713-156523735 CTGTGAGTGAGTTTGCCTGGAGG + Intergenic
1018837246 6:167494258-167494280 CTGCCTGGGAGGAGGCCTGAGGG + Intergenic
1019154603 6:170030792-170030814 CTCTCAGGGAGGAGGCGTGAGGG - Intergenic
1019431372 7:1001339-1001361 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431379 7:1001355-1001377 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431389 7:1001389-1001411 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431409 7:1001457-1001479 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431427 7:1001527-1001549 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431438 7:1001561-1001583 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431492 7:1001729-1001751 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431506 7:1001781-1001803 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431515 7:1001813-1001835 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431522 7:1001829-1001851 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431532 7:1001863-1001885 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431542 7:1001897-1001919 CTGTGGGTGGGGAGTCCTGCGGG + Intronic
1019431568 7:1001981-1002003 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431578 7:1002015-1002037 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431627 7:1002185-1002207 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431654 7:1002291-1002313 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431663 7:1002323-1002345 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431670 7:1002339-1002361 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431680 7:1002373-1002395 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431696 7:1002423-1002445 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431710 7:1002475-1002497 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431720 7:1002509-1002531 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431755 7:1002631-1002653 CTGTGGGTGGGGAGTCCTGCGGG + Intronic
1019431783 7:1002737-1002759 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431803 7:1002804-1002826 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431854 7:1002991-1003013 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431888 7:1003111-1003133 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431898 7:1003145-1003167 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431922 7:1003231-1003253 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431948 7:1003337-1003359 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431954 7:1003353-1003375 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431968 7:1003405-1003427 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431992 7:1003491-1003513 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432012 7:1003558-1003580 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432018 7:1003574-1003596 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432047 7:1003676-1003698 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432085 7:1003811-1003833 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432103 7:1003879-1003901 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432117 7:1003931-1003953 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432131 7:1003983-1004005 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019595637 7:1857124-1857146 CTGTTGGTGAGGAGTCCTGGAGG - Intronic
1019929048 7:4211362-4211384 CAGGGAGTGAGGAGGCCGGCCGG + Intronic
1023744646 7:43311644-43311666 CTGTGAGTGAGCTGCCCTGCTGG - Intronic
1024440270 7:49408434-49408456 AGGTGAATGAGGAGGCCAGAAGG - Intergenic
1026658982 7:72282477-72282499 CAGTGAGGGAGGAGCCCTCATGG - Intronic
1029414950 7:100436586-100436608 CTGTGAGTGCGGAAGCCTGCCGG - Intergenic
1030005247 7:105112186-105112208 CTGTGAATGATGAGGCCTGTAGG - Exonic
1030126975 7:106163056-106163078 CTGTGAGGGTGGAGTCCTTATGG + Intergenic
1030967864 7:116016309-116016331 CTGTCAGTGAGGAGACCTCAGGG + Intronic
1032415677 7:131733599-131733621 CTGTTGGGGAGGAGGCCTGCAGG + Intergenic
1032683634 7:134209715-134209737 TTTTGAGTGCGGAGGGCTGATGG - Intronic
1032859236 7:135861851-135861873 CTTTGTGTGTGGAGACCTGAAGG + Intergenic
1033419077 7:141189872-141189894 CTGTGCGTGTGGAACCCTGAAGG + Intronic
1034565220 7:151908716-151908738 CCGTGTGTGAGGGGGCCTGAAGG - Intergenic
1034955841 7:155334119-155334141 CTGAGAGTAATGAGGACTGAGGG - Intergenic
1035404101 7:158587347-158587369 CTCTGAGTGAGGGGGCATGCAGG - Intronic
1037504370 8:19515753-19515775 CTTTTAGAGAGGAGGCTTGATGG + Intronic
1037539644 8:19858461-19858483 CTGTGTGAGAGGGAGCCTGAAGG + Intergenic
1037717280 8:21411127-21411149 CTGTGAGTGAGGAGCCACGATGG - Intergenic
1039412768 8:37369349-37369371 CTGTGAGCCAGGAGGGCTTAGGG - Intergenic
1042812845 8:72845392-72845414 CTCTCAGTCAGGAGGCATGAGGG + Intronic
1044175795 8:89120604-89120626 CAGTGTGAGGGGAGGCCTGAAGG - Intergenic
1044488527 8:92783381-92783403 CTGTGTGTAAGGAGAGCTGACGG + Intergenic
1045330843 8:101154522-101154544 CTCTGAGGCAGGAGCCCTGAAGG + Intergenic
1045717938 8:105070324-105070346 CTTTGAGAGAGGAGGAATGAAGG - Intronic
1046962592 8:120126144-120126166 CTGTGTAATAGGAGGCCTGAGGG - Intronic
1049260794 8:141638059-141638081 CAGCGTGTGGGGAGGCCTGAGGG + Intergenic
1049435428 8:142584121-142584143 CTGTGAGTGAGTTGGAGTGAGGG + Intergenic
1049695978 8:143984512-143984534 CTGAAGGTGAGGAGTCCTGAGGG + Intronic
1056535855 9:87527030-87527052 CTGTGAAAGAGGACACCTGAAGG + Intronic
1057034911 9:91804974-91804996 CTGTGAGAAAGGAGGGCTAAGGG - Intronic
1058456094 9:105139497-105139519 CAGTTAGTGAGGAGCCCTGAAGG - Intergenic
1059158440 9:112011077-112011099 CTGAGATTGAGGAGACCTAAGGG + Intergenic
1059251518 9:112891075-112891097 CTGTGAGCGCGGCCGCCTGACGG + Intergenic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1060234572 9:121853410-121853432 CTGTGAGGGAGGGGACCTGGGGG + Intronic
1060751682 9:126173797-126173819 CAGCCAGGGAGGAGGCCTGAAGG - Intergenic
1061397172 9:130349514-130349536 CTGGGGGTGAGAAGGCGTGAGGG - Intronic
1061665123 9:132156202-132156224 CTGAGACTGAGGAGTCCTCAGGG + Intergenic
1062087109 9:134654591-134654613 CTGGGAGTGTGTAGGGCTGAGGG + Intronic
1062708674 9:137960025-137960047 CAGGAAGTGAGGACGCCTGAGGG + Intronic
1185558331 X:1038904-1038926 CTATGAGGGAGGAGCCATGATGG + Intergenic
1186900687 X:14052181-14052203 CTCTGAGTGAGGAGGAGTAAGGG + Intergenic
1188515144 X:30977402-30977424 CTGAGAGTGAGGAGGCAGAAAGG - Intergenic
1189638008 X:43033093-43033115 CTGAGAATCAGGAGGGCTGATGG - Intergenic
1190397646 X:50000976-50000998 CTGAGAGTGAGGAGGAAGGAAGG - Intronic
1191604847 X:63050313-63050335 CTGAGAGTGTGGAGGCCTCAGGG + Intergenic
1192547215 X:72023992-72024014 CTGTGCCCTAGGAGGCCTGAGGG + Intergenic
1195329573 X:103786168-103786190 CTGTGAGTTAGCATGTCTGAAGG + Intronic
1197625799 X:128801125-128801147 CAGTGAGAGCGAAGGCCTGAAGG + Intergenic
1199267276 X:145843376-145843398 CTGTGTGTGAGGCTGCCTGGGGG + Intergenic
1200073006 X:153538206-153538228 TTGTGTCTGAGGAGGACTGAGGG - Intronic
1200097592 X:153671501-153671523 CTGGGAGTGGGGTGGCCTGGGGG - Intronic
1201018435 Y:9626840-9626862 GTGTGAGTGAGGATGGCAGAGGG - Intergenic