ID: 1063666315

View in Genome Browser
Species Human (GRCh38)
Location 10:8062742-8062764
Sequence AGAGAGGGGAGGCCCAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063666315_1063666333 30 Left 1063666315 10:8062742-8062764 CCTCCTCTGGGCCTCCCCTCTCT No data
Right 1063666333 10:8062795-8062817 CCTGCAAGGAAGGGGAGTCCTGG No data
1063666315_1063666326 16 Left 1063666315 10:8062742-8062764 CCTCCTCTGGGCCTCCCCTCTCT No data
Right 1063666326 10:8062781-8062803 TTAAGCCTCCTGTTCCTGCAAGG No data
1063666315_1063666329 21 Left 1063666315 10:8062742-8062764 CCTCCTCTGGGCCTCCCCTCTCT No data
Right 1063666329 10:8062786-8062808 CCTCCTGTTCCTGCAAGGAAGGG No data
1063666315_1063666330 22 Left 1063666315 10:8062742-8062764 CCTCCTCTGGGCCTCCCCTCTCT No data
Right 1063666330 10:8062787-8062809 CTCCTGTTCCTGCAAGGAAGGGG No data
1063666315_1063666327 20 Left 1063666315 10:8062742-8062764 CCTCCTCTGGGCCTCCCCTCTCT No data
Right 1063666327 10:8062785-8062807 GCCTCCTGTTCCTGCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063666315 Original CRISPR AGAGAGGGGAGGCCCAGAGG AGG (reversed) Intronic