ID: 1063666322

View in Genome Browser
Species Human (GRCh38)
Location 10:8062756-8062778
Sequence CAAGTTGGTCCCCCAGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 199}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063666322_1063666330 8 Left 1063666322 10:8062756-8062778 CCCCTCTCTGGGGGACCAACTTG 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1063666330 10:8062787-8062809 CTCCTGTTCCTGCAAGGAAGGGG No data
1063666322_1063666329 7 Left 1063666322 10:8062756-8062778 CCCCTCTCTGGGGGACCAACTTG 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1063666329 10:8062786-8062808 CCTCCTGTTCCTGCAAGGAAGGG No data
1063666322_1063666333 16 Left 1063666322 10:8062756-8062778 CCCCTCTCTGGGGGACCAACTTG 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1063666333 10:8062795-8062817 CCTGCAAGGAAGGGGAGTCCTGG No data
1063666322_1063666326 2 Left 1063666322 10:8062756-8062778 CCCCTCTCTGGGGGACCAACTTG 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1063666326 10:8062781-8062803 TTAAGCCTCCTGTTCCTGCAAGG No data
1063666322_1063666327 6 Left 1063666322 10:8062756-8062778 CCCCTCTCTGGGGGACCAACTTG 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1063666327 10:8062785-8062807 GCCTCCTGTTCCTGCAAGGAAGG No data
1063666322_1063666334 26 Left 1063666322 10:8062756-8062778 CCCCTCTCTGGGGGACCAACTTG 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1063666334 10:8062805-8062827 AGGGGAGTCCTGGCTTTCTCTGG No data
1063666322_1063666335 27 Left 1063666322 10:8062756-8062778 CCCCTCTCTGGGGGACCAACTTG 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1063666335 10:8062806-8062828 GGGGAGTCCTGGCTTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063666322 Original CRISPR CAAGTTGGTCCCCCAGAGAG GGG (reversed) Intronic
900545109 1:3224411-3224433 GAAGCTGGTACCCCAGCGAGAGG - Intronic
904823454 1:33259371-33259393 CAAGTTGGTCCCACATGGAAAGG + Intronic
905235218 1:36541953-36541975 CAAGATGGGACCCCATAGAGGGG - Intergenic
905387536 1:37614749-37614771 CAGAATGGCCCCCCAGAGAGTGG + Intronic
906074081 1:43039210-43039232 CAGGATGGTCCCCCAGAGCTGGG - Intergenic
908087799 1:60654844-60654866 CAACTATGTCCCCCAGAAAGTGG + Intergenic
908715627 1:67066963-67066985 TAAATTGGTACCACAGAGAGTGG + Intergenic
908765794 1:67553716-67553738 CCAGTTCATCCCCCAGAAAGTGG - Intergenic
909810128 1:79923392-79923414 TAAATTGGTACCACAGAGAGTGG + Intergenic
914847361 1:151290524-151290546 CAAGGTGGTCCCCCGGCCAGGGG - Exonic
917228986 1:172815199-172815221 TAAATTGGTACCACAGAGAGTGG - Intergenic
919473884 1:198011084-198011106 TAAATTGGTACCACAGAGAGTGG - Intergenic
920427827 1:205892512-205892534 CAAGTCGGGCCACCAGATAGGGG + Intergenic
920721679 1:208393270-208393292 CAAGTTGTTGCCCCAGTGACTGG - Intergenic
923216788 1:231855977-231855999 CCAGATAGTCACCCAGAGAGTGG - Intronic
923427932 1:233890725-233890747 TAAGTTGGTATCACAGAGAGTGG + Intergenic
923891050 1:238215197-238215219 GAAATTGGTACCACAGAGAGTGG - Intergenic
1063666322 10:8062756-8062778 CAAGTTGGTCCCCCAGAGAGGGG - Intronic
1066490596 10:35890301-35890323 CAAGTTGGTGCCTCTGCGAGCGG - Intergenic
1069077487 10:64053092-64053114 TAAATTGGTACCCCAGAGAGTGG - Intergenic
1069134028 10:64741825-64741847 AAAGTTAGTTCCCCAGAAAGTGG + Intergenic
1069918773 10:71803314-71803336 CATGGTGGTGCCCCAGAGTGGGG - Exonic
1071738213 10:88326133-88326155 TAAATTGGTACCTCAGAGAGTGG + Intronic
1073126232 10:101151776-101151798 CAAGATGGTCTCCCAAAGCGTGG + Intergenic
1074426620 10:113357117-113357139 CAAGTTAGGTGCCCAGAGAGTGG - Intergenic
1074568808 10:114606105-114606127 ACAGTCTGTCCCCCAGAGAGAGG - Intronic
1074576770 10:114677088-114677110 CAGGAGGGTCCCCCAGAGGGAGG - Intronic
1076583908 10:131532539-131532561 AATGTGGGTCCCGCAGAGAGTGG + Intergenic
1076999705 11:316390-316412 CAAGTTTGCCTCCCAGAGGGCGG + Intergenic
1077465275 11:2730971-2730993 AAAGCTGGGCTCCCAGAGAGCGG - Intronic
1081388855 11:42504659-42504681 TAAATTGGTACCACAGAGAGTGG - Intergenic
1081710672 11:45213480-45213502 CAAGTCGGTCCTTCAGGGAGGGG + Intronic
1082858206 11:57828398-57828420 AAAGTTTGTCCCTCAAAGAGTGG + Intergenic
1083180837 11:60984046-60984068 CAAGTTAGACCACCGGAGAGGGG - Intronic
1089638393 11:119831395-119831417 CAGGTTGGACACCCAGAGATAGG + Intergenic
1094254083 12:28401107-28401129 TAAATTGGTACCACAGAGAGTGG - Intronic
1094415703 12:30212769-30212791 CAAGTTTGTCTCCCAGAGCTGGG - Intergenic
1099143189 12:79006201-79006223 CAAGTTGGCCTGCCAGAGACAGG - Intronic
1099492678 12:83306431-83306453 TAAATTGGTACCCCAGAGAGTGG + Intergenic
1099900060 12:88696329-88696351 TAAATTGGTACCACAGAGAGTGG - Intergenic
1100051853 12:90459201-90459223 TAAATTGGTACCACAGAGAGTGG + Intergenic
1101190328 12:102325959-102325981 TAAATTGGTACCACAGAGAGTGG + Intergenic
1101194756 12:102370771-102370793 TAAATTGGTACCACAGAGAGTGG - Intergenic
1102258898 12:111431321-111431343 CCAGGTGGTTCCCTAGAGAGAGG - Intronic
1103264420 12:119617046-119617068 TAAATTGGTACCACAGAGAGTGG + Intronic
1103539177 12:121654186-121654208 CCATTTGGTCCCACAGAGACAGG - Intronic
1106556852 13:30817196-30817218 AAAGCTGGTTCCCCAGAGACTGG - Intergenic
1106718666 13:32417573-32417595 CAAATTGGTACCACAGAGAATGG + Intronic
1108829063 13:54453892-54453914 TAAATTGGTACCACAGAGAGTGG - Intergenic
1111222186 13:85219792-85219814 CAAATTGGTACTGCAGAGAGTGG + Intergenic
1111271375 13:85891783-85891805 TAAATTGGTACCACAGAGAGTGG + Intergenic
1113076213 13:106470309-106470331 CACCTTGGCCACCCAGAGAGTGG + Intergenic
1113391086 13:109897836-109897858 GAAGTGAGTCCCCCAGACAGAGG - Intergenic
1113465177 13:110507671-110507693 CAAGTTGGATCACCAGGGAGTGG - Intronic
1119246445 14:73113333-73113355 CAAGTTGGCCTCCCAAAGTGCGG + Intronic
1120077268 14:80173013-80173035 CCAGTTGGTCCTCCCAAGAGTGG - Intergenic
1120818199 14:88884909-88884931 TAAGTTGGTACCACAGACAGTGG - Intergenic
1121728655 14:96171223-96171245 AAAGCTGCTCCCCCAGAGAACGG + Intergenic
1124556177 15:30727980-30728002 TAAATTGGTACCACAGAGAGTGG - Intronic
1127790975 15:62398424-62398446 TAAATTGGTACCGCAGAGAGTGG + Intronic
1128528463 15:68428453-68428475 CACAGTGGACCCCCAGAGAGGGG - Intronic
1130354480 15:83117242-83117264 CAGATTGGTGCCCCAGGGAGAGG - Intronic
1135947192 16:26875498-26875520 CAAGTTGTTGCCCCAGTGATTGG - Intergenic
1136642257 16:31576896-31576918 CAAATTGGTACCACAGAGTGGGG + Intergenic
1137265967 16:46869308-46869330 TAAATTGGTACCACAGAGAGTGG - Intergenic
1138209625 16:55152527-55152549 GAAGTTGTTCCACAAGAGAGAGG + Intergenic
1139033360 16:62912278-62912300 TAAATTGGTACCACAGAGAGAGG - Intergenic
1139653619 16:68374827-68374849 CCAGCTGGTCCACCAGAGACAGG - Intronic
1143119683 17:4599062-4599084 AGAGTTGCTGCCCCAGAGAGGGG - Intronic
1146569658 17:33941483-33941505 CAAGTGGGACCCCAAGAGAAAGG + Intronic
1148806705 17:50267454-50267476 CCAGCTGTCCCCCCAGAGAGAGG - Intergenic
1149072090 17:52555571-52555593 TAAATTGGTACCACAGAGAGTGG + Intergenic
1149158857 17:53666844-53666866 TAAATTGGTACCACAGAGAGTGG + Intergenic
1151166986 17:72212390-72212412 CAATTTGGCCCCCAAGAGATGGG + Intergenic
1151720179 17:75850592-75850614 CAAGTTGAGCCTCCAGAGATGGG + Intronic
1154129715 18:11726528-11726550 CGAGGAGGTGCCCCAGAGAGGGG - Intronic
1156102119 18:33609035-33609057 CTAGTTGTTCCCCCAGAAAGTGG + Intronic
1157818330 18:50747342-50747364 CAAGTTTCTGCCCCAGAGTGGGG - Intergenic
1159357556 18:67357552-67357574 TAAATTGGTACCACAGAGAGTGG + Intergenic
1159640526 18:70858671-70858693 TAAATTGGTACCACAGAGAGTGG + Intergenic
1159717851 18:71848429-71848451 CATATTGGTACCACAGAGAGTGG + Intergenic
1159767789 18:72510647-72510669 TAAATTGGTACCTCAGAGAGTGG - Intergenic
1161411345 19:4119804-4119826 CAAGGTGGACAGCCAGAGAGGGG + Intronic
1162493271 19:11007853-11007875 TCAGTTCATCCCCCAGAGAGGGG - Intronic
1162951068 19:14072532-14072554 CAGAATGGCCCCCCAGAGAGCGG + Exonic
1167467455 19:49657886-49657908 CAAGGTGGGCACCCGGAGAGAGG + Exonic
926280703 2:11443442-11443464 TAAATTGGTACCACAGAGAGTGG - Intergenic
926679247 2:15651376-15651398 CAGGTTCCTCCCGCAGAGAGGGG + Intergenic
930105049 2:47632925-47632947 GAAGTGGGTCCCACAGGGAGGGG - Intergenic
930456831 2:51616170-51616192 CAAATTGGTGCCACAGAGAGTGG - Intergenic
930626116 2:53699205-53699227 CAAGATGGTGCCCCAGTGATGGG - Intronic
932467841 2:71934949-71934971 CAGGCTGGGCCCACAGAGAGAGG - Intergenic
935323151 2:101907859-101907881 TAAATTGGTACCACAGAGAGTGG - Intergenic
936383025 2:112004446-112004468 CAAGTAAGTTCCCCAGAAAGAGG + Intronic
938681980 2:133701441-133701463 CAGGCAGGTCCCCAAGAGAGAGG - Intergenic
938836796 2:135112162-135112184 CAAGCTTGTCCCCCAAATAGTGG + Intronic
940728311 2:157361128-157361150 TAAATTGGTACCACAGAGAGTGG + Intergenic
946562329 2:220927116-220927138 TAAATTGGTACCACAGAGAGTGG - Intergenic
948096982 2:235343354-235343376 CAAGCAGCTCCCCCAGGGAGAGG - Intergenic
948584971 2:239013552-239013574 CAAGCTTGTCTCCCAGGGAGAGG - Intergenic
948837593 2:240633209-240633231 TAAATTGGTACCACAGAGAGTGG + Intergenic
1170750457 20:19140360-19140382 TAAATTGGTACCACAGAGAGTGG - Intergenic
1175568672 20:60001461-60001483 ACAGTTGGTCCCCCTGAGAGAGG + Intronic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1175695245 20:61098507-61098529 TCAGTTGGTCCCCCAGGGAGGGG - Intergenic
1177317264 21:19477977-19477999 TAAATTGGTACCACAGAGAGTGG - Intergenic
1177570383 21:22878423-22878445 TAAATTGGTACCACAGAGAGTGG - Intergenic
1177940446 21:27404012-27404034 CAAGTTGTTCAGCCAGAGCGTGG + Intergenic
1178189126 21:30260281-30260303 CAAGTAGGCCCCACAGTGAGAGG + Intergenic
1178920507 21:36735439-36735461 CAACAGGGACCCCCAGAGAGAGG - Intronic
1181603243 22:23964807-23964829 CAAGGTGGGAGCCCAGAGAGGGG - Intergenic
1181605271 22:23976500-23976522 CAAGGTGGGAGCCCAGAGAGGGG + Intronic
1182797683 22:33003201-33003223 TAAATTGGTACCCCAGAGAGTGG + Intronic
1182963627 22:34501395-34501417 CAGGATGGTCCTCCAGAGGGTGG - Intergenic
1182999480 22:34843345-34843367 TAAATTGGTACCACAGAGAGTGG + Intergenic
1183367772 22:37416402-37416424 AATGCTGGTCCCCCAGAGAACGG + Intronic
1184338758 22:43873748-43873770 TAAATTGGTACCACAGAGAGTGG + Intergenic
949367426 3:3298258-3298280 CACGTTGGTCACCCTGATAGTGG - Intergenic
950304957 3:11910362-11910384 CAATTTGTACCCCCAGAAAGCGG + Intergenic
954614103 3:51960749-51960771 CCAGTGAGTCCCCCAGAGGGTGG - Intronic
957374202 3:79335697-79335719 TAAATTGGTACCGCAGAGAGTGG + Intronic
957477235 3:80740297-80740319 TAAATTGGTACCTCAGAGAGTGG - Intergenic
958128276 3:89385646-89385668 TAAATTGGTACCACAGAGAGTGG + Intronic
959229594 3:103631456-103631478 TAAATTGGTACCACAGAGAGTGG + Intergenic
959311839 3:104748345-104748367 GAAGTTGGTACCCAAGAGTGGGG + Intergenic
960362788 3:116734627-116734649 AAAATTGGTACCACAGAGAGTGG + Intronic
963978046 3:151505093-151505115 TAAATTGGTACCACAGAGAGTGG - Intergenic
964274572 3:154995869-154995891 TAAATTGGTACCACAGAGAGTGG - Intergenic
964472377 3:157069038-157069060 CAAGTTTCTCCTGCAGAGAGTGG + Intergenic
965012221 3:163108245-163108267 TAAGTTGGTACTGCAGAGAGTGG - Intergenic
965258556 3:166448774-166448796 CAGGCTGGCCCACCAGAGAGAGG + Intergenic
968078339 3:195829513-195829535 TAAGCTGCTGCCCCAGAGAGGGG - Intergenic
970301973 4:14691312-14691334 AAAATTGGTACCACAGAGAGTGG + Intergenic
971119521 4:23688631-23688653 TAAATTGGTACCTCAGAGAGTGG + Intergenic
972033523 4:34492833-34492855 TAATTTGGTACCACAGAGAGTGG + Intergenic
973162955 4:47041306-47041328 CAAGTTGGTCTCCTGGAAAGAGG + Intronic
974895664 4:67935224-67935246 CAAGTTGGTCACAGAGGGAGAGG - Intronic
976726555 4:88221350-88221372 TAAATTGGTACCGCAGAGAGTGG + Intronic
978666115 4:111183753-111183775 TAAATTGGTACCACAGAGAGTGG - Intergenic
979277178 4:118827464-118827486 CAAGTTGGTCTCTCACACAGCGG + Intronic
980282854 4:130742773-130742795 TAAATTGGTACCACAGAGAGTGG + Intergenic
980408342 4:132382248-132382270 TAAATTGGTACCACAGAGAGTGG - Intergenic
982608995 4:157550459-157550481 TAAATTGGTACCACAGAGAGTGG + Intergenic
983713843 4:170753710-170753732 TAAATTTGTCCCACAGAGAGAGG + Intergenic
984512380 4:180694190-180694212 TAAGTTGGTACCACAAAGAGTGG - Intergenic
984699915 4:182812524-182812546 TAAATTGGTACCACAGAGAGTGG - Intergenic
985474011 5:67822-67844 TAAGTTGGTACCACAGAGAGTGG + Intergenic
988076738 5:26363654-26363676 AAACTTGGTACCACAGAGAGTGG + Intergenic
992618122 5:78565146-78565168 TAAGTTGGTCCCCTTGTGAGGGG - Intronic
994942648 5:106344919-106344941 CTACTTGGTACCACAGAGAGTGG + Intergenic
996499607 5:124202597-124202619 TAAATTGGTACCTCAGAGAGTGG + Intergenic
996829627 5:127726512-127726534 CAAGAAGGTCGCCCAGAGAAGGG + Intergenic
996911263 5:128659791-128659813 TAAATTGGTACCTCAGAGAGAGG + Intronic
997160938 5:131608728-131608750 CCAATTGGTTCCCCCGAGAGAGG + Intronic
997647486 5:135490835-135490857 GAAGTAGGTCTCCCAGAGCGGGG - Intergenic
998648553 5:144091459-144091481 CAAATTGGTCCTCCAGGGAGAGG + Intergenic
998753759 5:145353111-145353133 TAAATTGGTACCACAGAGAGTGG - Intergenic
998757040 5:145392120-145392142 TAAATTGGTACCACAGAGAGTGG - Intergenic
1000788162 5:165571485-165571507 TAAATTGGTACCACAGAGAGTGG - Intergenic
1001426397 5:171625454-171625476 CAAGTTGTTCCTCCAGACTGTGG + Intergenic
1002889995 6:1324099-1324121 GATGTTTGTCCCCCAGAGAGGGG - Intergenic
1005118017 6:22359614-22359636 CAAGAGGGTCCCTCAGGGAGAGG + Intergenic
1006693173 6:35908151-35908173 TAAATTGGTACCACAGAGAGTGG + Intronic
1008176300 6:48271446-48271468 CACGTTGGTCCCGCTGGGAGCGG + Intergenic
1010269295 6:73903101-73903123 GAACTTGCTCTCCCAGAGAGGGG - Intergenic
1010473737 6:76261827-76261849 TAAATTGGTACCACAGAGAGTGG + Intergenic
1011876166 6:91965174-91965196 TAAATTGGTACCACAGAGAGTGG + Intergenic
1012078782 6:94728554-94728576 TAAATTGGTACCACAGAGAGTGG - Intergenic
1015487776 6:133791191-133791213 TAAATTGGTACCACAGAGAGTGG - Intergenic
1016611958 6:145999819-145999841 TAAATTGGTACCGCAGAGAGTGG - Intergenic
1016790345 6:148060967-148060989 TAAGTTGGTACTGCAGAGAGTGG - Intergenic
1021573420 7:22086877-22086899 TAAATTGGTACCACAGAGAGTGG - Intergenic
1021762157 7:23912728-23912750 TAAATTGGTACCACAGAGAGTGG + Intergenic
1023998967 7:45178554-45178576 CAAGCAGTTCCCCCACAGAGTGG - Intronic
1024384647 7:48737940-48737962 TAAATTGGTACCACAGAGAGTGG + Intergenic
1028844045 7:95460186-95460208 TAAATTGGTACCACAGAGAGTGG + Intergenic
1032268822 7:130385873-130385895 GAACTTGGTCCCGTAGAGAGAGG - Exonic
1033614349 7:142998063-142998085 AAAGTTGCTCCCTCAGAGAAAGG + Intergenic
1034882368 7:154772367-154772389 CATACTTGTCCCCCAGAGAGTGG + Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1041430562 8:57776979-57777001 CAAATTGGTACCTCAGAGAGTGG + Intergenic
1041494304 8:58468986-58469008 TAAATTGGTACCACAGAGAGTGG + Intergenic
1043492604 8:80764165-80764187 TAAATTGGTACCACAGAGAGTGG - Intronic
1046170274 8:110497045-110497067 TAAATTGGTACCACAGAGAGTGG + Intergenic
1046831358 8:118750421-118750443 TAAGTTGGTACTGCAGAGAGTGG + Intergenic
1047115859 8:121841400-121841422 TAAATTGGTACCACAGAGAGTGG + Intergenic
1047562925 8:126008856-126008878 CAAGTCAGGCCGCCAGAGAGGGG + Intergenic
1048547254 8:135398627-135398649 CAAGTTCCTCCCGCTGAGAGTGG - Intergenic
1049742899 8:144249552-144249574 CAAGGCCGTCCCCCAGAGTGAGG + Intronic
1049878056 8:145040002-145040024 CAACCTGGTCACCCAGTGAGTGG + Intergenic
1052271474 9:26632425-26632447 CAAGGTGTTCCCCCAGTCAGGGG - Intergenic
1056630473 9:88289188-88289210 CACGTTGGTGCCCTAGACAGTGG + Intergenic
1058131972 9:101263977-101263999 TAAGTTTGACCCCCTGAGAGGGG - Intronic
1058402906 9:104637536-104637558 CAACTTGGACACCAAGAGAGAGG - Intergenic
1058833295 9:108838362-108838384 CAACTTGGTGCCTCAGTGAGAGG - Intergenic
1188624206 X:32264398-32264420 TAAATTGGTACCACAGAGAGTGG + Intronic
1188692691 X:33149806-33149828 CAAGTTGATACCACATAGAGTGG + Intronic
1188774063 X:34190554-34190576 AAAATTGGTACCACAGAGAGTGG - Intergenic
1188926412 X:36050155-36050177 TAAATTGGTACCACAGAGAGTGG + Intronic
1190408485 X:50111293-50111315 CACTTTGGTCTCCCAAAGAGAGG - Intergenic
1191742434 X:64450048-64450070 TAAATTGGTGCCACAGAGAGTGG - Intergenic
1192334853 X:70209971-70209993 CAAATTGGCACCACAGAGAGTGG + Intergenic
1193506388 X:82349355-82349377 CAAATTGGTACCACAGAGAGTGG - Intergenic
1193682569 X:84540617-84540639 TAAATTGGTACCACAGAGAGTGG + Intergenic
1194049746 X:89054081-89054103 TAAATTGGTACCTCAGAGAGTGG - Intergenic
1194084284 X:89506593-89506615 TAAATTGGTACCACAGAGAGTGG - Intergenic
1194756196 X:97742552-97742574 TAAATTGGTACCACAGAGAGTGG + Intergenic
1196930534 X:120676975-120676997 TAAATTGGTACCACAGAGAGTGG - Intergenic
1197368683 X:125599778-125599800 TAAATTGGTACCACAGAGAGTGG + Intergenic
1197451981 X:126630121-126630143 TAAATTGGTACCACAGAGAGTGG - Intergenic
1198912720 X:141632819-141632841 CAAATTGGTACCGCAGAGAGTGG + Intronic
1199185581 X:144911505-144911527 TAAATTGGTACCACAGAGAGTGG - Intergenic
1200436923 Y:3162480-3162502 TAAATTGGTACCACAGAGAGTGG - Intergenic