ID: 1063666323

View in Genome Browser
Species Human (GRCh38)
Location 10:8062757-8062779
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063666323_1063666329 6 Left 1063666323 10:8062757-8062779 CCCTCTCTGGGGGACCAACTTGA No data
Right 1063666329 10:8062786-8062808 CCTCCTGTTCCTGCAAGGAAGGG No data
1063666323_1063666327 5 Left 1063666323 10:8062757-8062779 CCCTCTCTGGGGGACCAACTTGA No data
Right 1063666327 10:8062785-8062807 GCCTCCTGTTCCTGCAAGGAAGG No data
1063666323_1063666326 1 Left 1063666323 10:8062757-8062779 CCCTCTCTGGGGGACCAACTTGA No data
Right 1063666326 10:8062781-8062803 TTAAGCCTCCTGTTCCTGCAAGG No data
1063666323_1063666333 15 Left 1063666323 10:8062757-8062779 CCCTCTCTGGGGGACCAACTTGA No data
Right 1063666333 10:8062795-8062817 CCTGCAAGGAAGGGGAGTCCTGG No data
1063666323_1063666334 25 Left 1063666323 10:8062757-8062779 CCCTCTCTGGGGGACCAACTTGA No data
Right 1063666334 10:8062805-8062827 AGGGGAGTCCTGGCTTTCTCTGG No data
1063666323_1063666330 7 Left 1063666323 10:8062757-8062779 CCCTCTCTGGGGGACCAACTTGA No data
Right 1063666330 10:8062787-8062809 CTCCTGTTCCTGCAAGGAAGGGG No data
1063666323_1063666335 26 Left 1063666323 10:8062757-8062779 CCCTCTCTGGGGGACCAACTTGA No data
Right 1063666335 10:8062806-8062828 GGGGAGTCCTGGCTTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063666323 Original CRISPR TCAAGTTGGTCCCCCAGAGA GGG (reversed) Intronic