ID: 1063666324

View in Genome Browser
Species Human (GRCh38)
Location 10:8062758-8062780
Sequence CTCAAGTTGGTCCCCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063666324_1063666329 5 Left 1063666324 10:8062758-8062780 CCTCTCTGGGGGACCAACTTGAG No data
Right 1063666329 10:8062786-8062808 CCTCCTGTTCCTGCAAGGAAGGG No data
1063666324_1063666334 24 Left 1063666324 10:8062758-8062780 CCTCTCTGGGGGACCAACTTGAG No data
Right 1063666334 10:8062805-8062827 AGGGGAGTCCTGGCTTTCTCTGG No data
1063666324_1063666330 6 Left 1063666324 10:8062758-8062780 CCTCTCTGGGGGACCAACTTGAG No data
Right 1063666330 10:8062787-8062809 CTCCTGTTCCTGCAAGGAAGGGG No data
1063666324_1063666327 4 Left 1063666324 10:8062758-8062780 CCTCTCTGGGGGACCAACTTGAG No data
Right 1063666327 10:8062785-8062807 GCCTCCTGTTCCTGCAAGGAAGG No data
1063666324_1063666333 14 Left 1063666324 10:8062758-8062780 CCTCTCTGGGGGACCAACTTGAG No data
Right 1063666333 10:8062795-8062817 CCTGCAAGGAAGGGGAGTCCTGG No data
1063666324_1063666326 0 Left 1063666324 10:8062758-8062780 CCTCTCTGGGGGACCAACTTGAG No data
Right 1063666326 10:8062781-8062803 TTAAGCCTCCTGTTCCTGCAAGG No data
1063666324_1063666335 25 Left 1063666324 10:8062758-8062780 CCTCTCTGGGGGACCAACTTGAG No data
Right 1063666335 10:8062806-8062828 GGGGAGTCCTGGCTTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063666324 Original CRISPR CTCAAGTTGGTCCCCCAGAG AGG (reversed) Intronic