ID: 1063666325

View in Genome Browser
Species Human (GRCh38)
Location 10:8062771-8062793
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063666325_1063666334 11 Left 1063666325 10:8062771-8062793 CCAACTTGAGTTAAGCCTCCTGT No data
Right 1063666334 10:8062805-8062827 AGGGGAGTCCTGGCTTTCTCTGG No data
1063666325_1063666337 27 Left 1063666325 10:8062771-8062793 CCAACTTGAGTTAAGCCTCCTGT No data
Right 1063666337 10:8062821-8062843 TCTCTGGGCACCCAGAGAACTGG No data
1063666325_1063666335 12 Left 1063666325 10:8062771-8062793 CCAACTTGAGTTAAGCCTCCTGT No data
Right 1063666335 10:8062806-8062828 GGGGAGTCCTGGCTTTCTCTGGG No data
1063666325_1063666333 1 Left 1063666325 10:8062771-8062793 CCAACTTGAGTTAAGCCTCCTGT No data
Right 1063666333 10:8062795-8062817 CCTGCAAGGAAGGGGAGTCCTGG No data
1063666325_1063666338 28 Left 1063666325 10:8062771-8062793 CCAACTTGAGTTAAGCCTCCTGT No data
Right 1063666338 10:8062822-8062844 CTCTGGGCACCCAGAGAACTGGG No data
1063666325_1063666330 -7 Left 1063666325 10:8062771-8062793 CCAACTTGAGTTAAGCCTCCTGT No data
Right 1063666330 10:8062787-8062809 CTCCTGTTCCTGCAAGGAAGGGG No data
1063666325_1063666327 -9 Left 1063666325 10:8062771-8062793 CCAACTTGAGTTAAGCCTCCTGT No data
Right 1063666327 10:8062785-8062807 GCCTCCTGTTCCTGCAAGGAAGG No data
1063666325_1063666329 -8 Left 1063666325 10:8062771-8062793 CCAACTTGAGTTAAGCCTCCTGT No data
Right 1063666329 10:8062786-8062808 CCTCCTGTTCCTGCAAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063666325 Original CRISPR ACAGGAGGCTTAACTCAAGT TGG (reversed) Intronic