ID: 1063666326

View in Genome Browser
Species Human (GRCh38)
Location 10:8062781-8062803
Sequence TTAAGCCTCCTGTTCCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063666323_1063666326 1 Left 1063666323 10:8062757-8062779 CCCTCTCTGGGGGACCAACTTGA No data
Right 1063666326 10:8062781-8062803 TTAAGCCTCCTGTTCCTGCAAGG No data
1063666322_1063666326 2 Left 1063666322 10:8062756-8062778 CCCCTCTCTGGGGGACCAACTTG No data
Right 1063666326 10:8062781-8062803 TTAAGCCTCCTGTTCCTGCAAGG No data
1063666314_1063666326 23 Left 1063666314 10:8062735-8062757 CCGGGGTCCTCCTCTGGGCCTCC No data
Right 1063666326 10:8062781-8062803 TTAAGCCTCCTGTTCCTGCAAGG No data
1063666321_1063666326 5 Left 1063666321 10:8062753-8062775 CCTCCCCTCTCTGGGGGACCAAC No data
Right 1063666326 10:8062781-8062803 TTAAGCCTCCTGTTCCTGCAAGG No data
1063666312_1063666326 27 Left 1063666312 10:8062731-8062753 CCCTCCGGGGTCCTCCTCTGGGC No data
Right 1063666326 10:8062781-8062803 TTAAGCCTCCTGTTCCTGCAAGG No data
1063666313_1063666326 26 Left 1063666313 10:8062732-8062754 CCTCCGGGGTCCTCCTCTGGGCC No data
Right 1063666326 10:8062781-8062803 TTAAGCCTCCTGTTCCTGCAAGG No data
1063666315_1063666326 16 Left 1063666315 10:8062742-8062764 CCTCCTCTGGGCCTCCCCTCTCT No data
Right 1063666326 10:8062781-8062803 TTAAGCCTCCTGTTCCTGCAAGG No data
1063666324_1063666326 0 Left 1063666324 10:8062758-8062780 CCTCTCTGGGGGACCAACTTGAG No data
Right 1063666326 10:8062781-8062803 TTAAGCCTCCTGTTCCTGCAAGG No data
1063666317_1063666326 13 Left 1063666317 10:8062745-8062767 CCTCTGGGCCTCCCCTCTCTGGG No data
Right 1063666326 10:8062781-8062803 TTAAGCCTCCTGTTCCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063666326 Original CRISPR TTAAGCCTCCTGTTCCTGCA AGG Intronic