ID: 1063666329

View in Genome Browser
Species Human (GRCh38)
Location 10:8062786-8062808
Sequence CCTCCTGTTCCTGCAAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063666325_1063666329 -8 Left 1063666325 10:8062771-8062793 CCAACTTGAGTTAAGCCTCCTGT No data
Right 1063666329 10:8062786-8062808 CCTCCTGTTCCTGCAAGGAAGGG No data
1063666322_1063666329 7 Left 1063666322 10:8062756-8062778 CCCCTCTCTGGGGGACCAACTTG No data
Right 1063666329 10:8062786-8062808 CCTCCTGTTCCTGCAAGGAAGGG No data
1063666315_1063666329 21 Left 1063666315 10:8062742-8062764 CCTCCTCTGGGCCTCCCCTCTCT No data
Right 1063666329 10:8062786-8062808 CCTCCTGTTCCTGCAAGGAAGGG No data
1063666321_1063666329 10 Left 1063666321 10:8062753-8062775 CCTCCCCTCTCTGGGGGACCAAC No data
Right 1063666329 10:8062786-8062808 CCTCCTGTTCCTGCAAGGAAGGG No data
1063666314_1063666329 28 Left 1063666314 10:8062735-8062757 CCGGGGTCCTCCTCTGGGCCTCC No data
Right 1063666329 10:8062786-8062808 CCTCCTGTTCCTGCAAGGAAGGG No data
1063666323_1063666329 6 Left 1063666323 10:8062757-8062779 CCCTCTCTGGGGGACCAACTTGA No data
Right 1063666329 10:8062786-8062808 CCTCCTGTTCCTGCAAGGAAGGG No data
1063666324_1063666329 5 Left 1063666324 10:8062758-8062780 CCTCTCTGGGGGACCAACTTGAG No data
Right 1063666329 10:8062786-8062808 CCTCCTGTTCCTGCAAGGAAGGG No data
1063666317_1063666329 18 Left 1063666317 10:8062745-8062767 CCTCTGGGCCTCCCCTCTCTGGG No data
Right 1063666329 10:8062786-8062808 CCTCCTGTTCCTGCAAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063666329 Original CRISPR CCTCCTGTTCCTGCAAGGAA GGG Intronic