ID: 1063667169

View in Genome Browser
Species Human (GRCh38)
Location 10:8069755-8069777
Sequence TGTCTAGCATAGCCGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063667166_1063667169 19 Left 1063667166 10:8069713-8069735 CCAAATAATTGATGCAATAGGAC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1063667169 10:8069755-8069777 TGTCTAGCATAGCCGTGCTGAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1063667168_1063667169 -3 Left 1063667168 10:8069735-8069757 CCTAGCTTGGAAAACTACTTTGT 0: 1
1: 0
2: 0
3: 25
4: 228
Right 1063667169 10:8069755-8069777 TGTCTAGCATAGCCGTGCTGAGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063667169 Original CRISPR TGTCTAGCATAGCCGTGCTG AGG Intronic
901621151 1:10588624-10588646 TGTCCAGCTTATCCATGCTGTGG + Intronic
902452451 1:16505734-16505756 TTTCTAGGATTTCCGTGCTGGGG - Intergenic
907257960 1:53194403-53194425 TGTCTAGCACAGGCCTACTGTGG - Intergenic
909482544 1:76141360-76141382 AGTCTAGCATGCCAGTGCTGGGG - Intronic
916103002 1:161408969-161408991 TGTCGAGCATAACAGTGCAGAGG - Intergenic
920644642 1:207791499-207791521 CGTCCAGCATACCCATGCTGTGG - Intronic
922593438 1:226796205-226796227 TGTCTAGCTTGGCCCTCCTGGGG + Intergenic
923217720 1:231864983-231865005 GGTCTACCACAGCCGTGGTGTGG - Intronic
1063667169 10:8069755-8069777 TGTCTAGCATAGCCGTGCTGAGG + Intronic
1078011769 11:7577744-7577766 TGTCCAGCAAAGCCCTGCTGTGG + Intronic
1081929192 11:46856803-46856825 TGTCTGGCAGACCCATGCTGTGG - Intergenic
1087661270 11:100991325-100991347 TGTCTGGCATTGCCTTCCTGTGG - Intronic
1092523377 12:9294852-9294874 TCTCTAGCATCTCCCTGCTGAGG - Intergenic
1092543917 12:9437047-9437069 TCTCTAGCATCTCCCTGCTGAGG + Intergenic
1094509029 12:31085004-31085026 TCTCTAGCATCTCCCTGCTGAGG - Exonic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1105904340 13:24790994-24791016 TGTCTAATATAGCAGTGCTTTGG - Intronic
1114035447 14:18622264-18622286 TGTCTGGCATTGCCTTCCTGTGG + Intergenic
1114123190 14:19692758-19692780 TGTCTGGCATTGCCTTCCTGTGG - Intergenic
1122140573 14:99660605-99660627 TGTCTATCATAGAGGTACTGAGG - Intronic
1122317940 14:100836610-100836632 TGTTCAGCAAAGCCGTACTGAGG - Intergenic
1123827646 15:24099744-24099766 TGTCTTGGATAGGCGTGGTGTGG - Intergenic
1129157753 15:73729273-73729295 TCTCCAGCAGAGCTGTGCTGAGG + Intergenic
1133454778 16:5932491-5932513 TGTCTAGCATGGCATGGCTGGGG - Intergenic
1142717486 17:1755004-1755026 TGTCTGGCACAGCCTGGCTGTGG + Exonic
1149564468 17:57631178-57631200 TGTCTTGCATGGCCCTGCTAGGG - Intronic
1149598280 17:57876699-57876721 GGTCTAGCAGAGCCATCCTGGGG + Intronic
1160419855 18:78736465-78736487 TGTCTCGCAGAGGTGTGCTGGGG - Intergenic
1164531415 19:29051134-29051156 TGTGAATCAGAGCCGTGCTGTGG + Intergenic
926822121 2:16863893-16863915 TGCCTAGCATAGCCTTCCTATGG - Intergenic
928409268 2:31041871-31041893 TGTGAAGCAGAGCCATGCTGAGG + Intronic
929770229 2:44885627-44885649 TGTCTTTCATGGCCGTGTTGGGG + Intergenic
933268368 2:80206317-80206339 TTTCAGGCATAGCCTTGCTGGGG + Intronic
935071507 2:99698370-99698392 TGTCCAGCATTGGGGTGCTGGGG + Intronic
938274954 2:130010700-130010722 TGTCTGGCATTGCCTTCCTGTGG - Intergenic
942648789 2:178145179-178145201 GTTCTAGCATTGCTGTGCTGAGG + Intergenic
944864889 2:203850464-203850486 TGTCCAGCATATCAGTTCTGGGG - Intergenic
946016074 2:216605081-216605103 AGTCTAGCAGAGCAGTGATGAGG - Intergenic
1178038892 21:28617147-28617169 GGTCTGGAATAGCCTTGCTGAGG + Intergenic
1180082216 21:45492121-45492143 CTCCTAGCAAAGCCGTGCTGGGG - Intronic
1180459568 22:15549318-15549340 TGTCTGGCATTGCCTTCCTGTGG + Intergenic
1185176842 22:49332684-49332706 AGTCTCGCATGGCGGTGCTGGGG - Intergenic
959310487 3:104729696-104729718 TGTCTAGCAGAGCCATGGTTGGG - Intergenic
960994158 3:123330115-123330137 TGTCTAGCTCAGGCTTGCTGGGG + Intronic
961330700 3:126136310-126136332 TATCTACCATAGGCGTGCTTTGG + Intronic
968464365 4:743087-743109 TGTCTGGCATGGCACTGCTGTGG + Intronic
976686600 4:87821157-87821179 TCTCTAGCGTAGGCTTGCTGAGG + Intergenic
998994509 5:147855845-147855867 TGTCTGGAGTACCCGTGCTGTGG + Intergenic
1009936645 6:70242125-70242147 TGTCTAAAATAAACGTGCTGTGG + Intronic
1016354781 6:143206579-143206601 TGTCTACCATAGCCTTACAGTGG + Intronic
1020044688 7:5032095-5032117 TGTCCAGCAGAGCCCTCCTGAGG - Intronic
1020290042 7:6716117-6716139 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1023825641 7:44007109-44007131 TGTCCAGCAGAGCCCTCCTGAGG + Intronic
1024061981 7:45704830-45704852 TGTCTAGCAGGGCAGGGCTGGGG - Intronic
1026089193 7:67285885-67285907 TGTCCAGCAGAGCCCTCCTGAGG + Intergenic
1026725058 7:72864465-72864487 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1026747190 7:73022661-73022683 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1026750840 7:73050804-73050826 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1026754489 7:73078914-73078936 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1026758141 7:73106947-73106969 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1027033294 7:74907232-74907254 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1027089264 7:75286537-75286559 TGTCCAGCAGAGCCCTCCTGAGG + Intergenic
1027092907 7:75314465-75314487 TGTCCAGCAGAGCCCTCCTGAGG + Intergenic
1027096550 7:75342432-75342454 TGTCCAGCAGAGCCCTCCTGAGG + Intergenic
1027118783 7:75501203-75501225 TGTCCAGCAGAGCCCTCCTGAGG + Intergenic
1027273013 7:76534256-76534278 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1027322797 7:77025248-77025270 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1027326462 7:77053340-77053362 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1029397659 7:100319406-100319428 TGTCCAGCAGAGCCCTCCTGAGG + Intronic
1029718704 7:102348814-102348836 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1029753911 7:102560441-102560463 TGTCCAGCAGAGCCCTCCTGAGG + Intronic
1029771861 7:102659531-102659553 TGTCCAGCAGAGCCCTCCTGAGG + Intronic
1032794406 7:135266239-135266261 GGTCTAGCATCTCCATGCTGTGG - Intergenic
1040870683 8:52097684-52097706 TGTCCAGCAGTGCAGTGCTGTGG + Intergenic
1041375758 8:57208299-57208321 TGTCTAGAAAAGGCGAGCTGAGG + Intergenic
1041376520 8:57212678-57212700 TGTCTAGAAAAGGCGAGCTGAGG + Intergenic
1041642121 8:60214522-60214544 TGTCAAACATAACCATGCTGTGG + Intronic
1043304392 8:78776275-78776297 TGTCTAGCAGAACCGGGCTGTGG - Intronic
1044951527 8:97440056-97440078 TGTCCAGCATACCCATGCTGTGG - Intergenic
1046435709 8:114185854-114185876 TGTCAGGCATAGCCTTGCTGAGG - Intergenic
1049248056 8:141573197-141573219 TGTCTCCCATAGGCGTGCTGGGG + Intergenic
1049420450 8:142514090-142514112 TGCCTAGCTTAGCCTGGCTGGGG + Intronic
1056278771 9:85019294-85019316 TGTGTAGCATGGTGGTGCTGGGG + Intronic
1057852705 9:98577588-98577610 TGTCTGGCAAGGCTGTGCTGTGG + Intronic
1060744930 9:126125075-126125097 GCTCTCGTATAGCCGTGCTGTGG + Intergenic
1203774836 EBV:67096-67118 TCTACAGCATAGCCCTGCTGCGG + Intergenic
1188003888 X:25004751-25004773 CCTCTAGCATAGCCGCGCTGAGG - Exonic
1188128154 X:26397239-26397261 TGTACAGCAAAGCTGTGCTGGGG - Intergenic
1189407231 X:40735812-40735834 TGTCTAGCACCGCAGCGCTGGGG + Intronic
1189461049 X:41243359-41243381 TGTCAGGCATATCCTTGCTGGGG + Intergenic
1192337731 X:70235975-70235997 TCTCTAGCAGAGCCATGCTAGGG + Intronic
1199483033 X:148318951-148318973 TGTCCAGCATAGCCATGCTAGGG + Intergenic