ID: 1063669680

View in Genome Browser
Species Human (GRCh38)
Location 10:8089916-8089938
Sequence GCTAGGTGCAAGAGTAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063669680_1063669686 22 Left 1063669680 10:8089916-8089938 CCTGAATTACTCTTGCACCTAGC No data
Right 1063669686 10:8089961-8089983 CCCGTGTGGCATAAAATAGGTGG No data
1063669680_1063669682 8 Left 1063669680 10:8089916-8089938 CCTGAATTACTCTTGCACCTAGC No data
Right 1063669682 10:8089947-8089969 TGAAACCAAACATTCCCGTGTGG No data
1063669680_1063669684 19 Left 1063669680 10:8089916-8089938 CCTGAATTACTCTTGCACCTAGC No data
Right 1063669684 10:8089958-8089980 ATTCCCGTGTGGCATAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063669680 Original CRISPR GCTAGGTGCAAGAGTAATTC AGG (reversed) Intergenic
No off target data available for this crispr