ID: 1063669681

View in Genome Browser
Species Human (GRCh38)
Location 10:8089933-8089955
Sequence TTGGTTTCACAGTGTGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063669681_1063669684 2 Left 1063669681 10:8089933-8089955 CCTAGCACACACTGTGAAACCAA No data
Right 1063669684 10:8089958-8089980 ATTCCCGTGTGGCATAAAATAGG No data
1063669681_1063669686 5 Left 1063669681 10:8089933-8089955 CCTAGCACACACTGTGAAACCAA No data
Right 1063669686 10:8089961-8089983 CCCGTGTGGCATAAAATAGGTGG No data
1063669681_1063669682 -9 Left 1063669681 10:8089933-8089955 CCTAGCACACACTGTGAAACCAA No data
Right 1063669682 10:8089947-8089969 TGAAACCAAACATTCCCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063669681 Original CRISPR TTGGTTTCACAGTGTGTGCT AGG (reversed) Intergenic
No off target data available for this crispr