ID: 1063669684

View in Genome Browser
Species Human (GRCh38)
Location 10:8089958-8089980
Sequence ATTCCCGTGTGGCATAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063669681_1063669684 2 Left 1063669681 10:8089933-8089955 CCTAGCACACACTGTGAAACCAA No data
Right 1063669684 10:8089958-8089980 ATTCCCGTGTGGCATAAAATAGG No data
1063669680_1063669684 19 Left 1063669680 10:8089916-8089938 CCTGAATTACTCTTGCACCTAGC No data
Right 1063669684 10:8089958-8089980 ATTCCCGTGTGGCATAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063669684 Original CRISPR ATTCCCGTGTGGCATAAAAT AGG Intergenic
No off target data available for this crispr