ID: 1063669978

View in Genome Browser
Species Human (GRCh38)
Location 10:8092259-8092281
Sequence CTCCCAAAGCATTCAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063669970_1063669978 10 Left 1063669970 10:8092226-8092248 CCAATCAAGCCCTGACCTCTTAC No data
Right 1063669978 10:8092259-8092281 CTCCCAAAGCATTCAGGCCAGGG No data
1063669972_1063669978 0 Left 1063669972 10:8092236-8092258 CCTGACCTCTTACCTAGACCAGT No data
Right 1063669978 10:8092259-8092281 CTCCCAAAGCATTCAGGCCAGGG No data
1063669973_1063669978 -5 Left 1063669973 10:8092241-8092263 CCTCTTACCTAGACCAGTCTCCC No data
Right 1063669978 10:8092259-8092281 CTCCCAAAGCATTCAGGCCAGGG No data
1063669969_1063669978 23 Left 1063669969 10:8092213-8092235 CCTTGTTTCAGGGCCAATCAAGC No data
Right 1063669978 10:8092259-8092281 CTCCCAAAGCATTCAGGCCAGGG No data
1063669971_1063669978 1 Left 1063669971 10:8092235-8092257 CCCTGACCTCTTACCTAGACCAG No data
Right 1063669978 10:8092259-8092281 CTCCCAAAGCATTCAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063669978 Original CRISPR CTCCCAAAGCATTCAGGCCA GGG Intergenic
No off target data available for this crispr