ID: 1063671050

View in Genome Browser
Species Human (GRCh38)
Location 10:8100382-8100404
Sequence CTGATTAAACAGATGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063671050_1063671051 4 Left 1063671050 10:8100382-8100404 CCTTTGTTCATCTGTTTAATCAG No data
Right 1063671051 10:8100409-8100431 TTGTCCTAGAGAGTCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063671050 Original CRISPR CTGATTAAACAGATGAACAA AGG (reversed) Intergenic
No off target data available for this crispr