ID: 1063680902

View in Genome Browser
Species Human (GRCh38)
Location 10:8186928-8186950
Sequence TAGTAGCCATAGTATTCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063680902_1063680903 -2 Left 1063680902 10:8186928-8186950 CCAAGTGAATACTATGGCTACTA No data
Right 1063680903 10:8186949-8186971 TAAAACCTACAAGAAGTCAGAGG No data
1063680902_1063680905 0 Left 1063680902 10:8186928-8186950 CCAAGTGAATACTATGGCTACTA No data
Right 1063680905 10:8186951-8186973 AAACCTACAAGAAGTCAGAGGGG No data
1063680902_1063680904 -1 Left 1063680902 10:8186928-8186950 CCAAGTGAATACTATGGCTACTA No data
Right 1063680904 10:8186950-8186972 AAAACCTACAAGAAGTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063680902 Original CRISPR TAGTAGCCATAGTATTCACT TGG (reversed) Intergenic
No off target data available for this crispr