ID: 1063681238

View in Genome Browser
Species Human (GRCh38)
Location 10:8189641-8189663
Sequence TGAGATCTACGTAGCTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063681236_1063681238 -5 Left 1063681236 10:8189623-8189645 CCAGGGGATTTTGTAACGTGAGA No data
Right 1063681238 10:8189641-8189663 TGAGATCTACGTAGCTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063681238 Original CRISPR TGAGATCTACGTAGCTCTGG TGG Intergenic
No off target data available for this crispr