ID: 1063688198

View in Genome Browser
Species Human (GRCh38)
Location 10:8258477-8258499
Sequence GAGTTAGCCCTGAGGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063688198_1063688208 30 Left 1063688198 10:8258477-8258499 CCTCCCATCCTCAGGGCTAACTC No data
Right 1063688208 10:8258530-8258552 TGTCACATCAGATTGCCAGGTGG No data
1063688198_1063688207 27 Left 1063688198 10:8258477-8258499 CCTCCCATCCTCAGGGCTAACTC No data
Right 1063688207 10:8258527-8258549 TGCTGTCACATCAGATTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063688198 Original CRISPR GAGTTAGCCCTGAGGATGGG AGG (reversed) Intergenic
No off target data available for this crispr