ID: 1063689052

View in Genome Browser
Species Human (GRCh38)
Location 10:8266267-8266289
Sequence CGGAGGGGATGGAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1646
Summary {0: 1, 1: 0, 2: 11, 3: 171, 4: 1463}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063689043_1063689052 1 Left 1063689043 10:8266243-8266265 CCTGTATCTACCTTTTTTTTTTT No data
Right 1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG 0: 1
1: 0
2: 11
3: 171
4: 1463
1063689042_1063689052 2 Left 1063689042 10:8266242-8266264 CCCTGTATCTACCTTTTTTTTTT No data
Right 1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG 0: 1
1: 0
2: 11
3: 171
4: 1463
1063689048_1063689052 -9 Left 1063689048 10:8266253-8266275 CCTTTTTTTTTTTCCGGAGGGGA 0: 1
1: 0
2: 5
3: 57
4: 473
Right 1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG 0: 1
1: 0
2: 11
3: 171
4: 1463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063689052 Original CRISPR CGGAGGGGATGGAGAGAAGA GGG Intergenic
900003525 1:29232-29254 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900023245 1:199748-199770 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900077248 1:827563-827585 GGGAGGGGAGGCAGAGAAAAAGG + Intergenic
900204828 1:1427391-1427413 TGGAGGGAAGGGGGAGAAGAGGG - Intronic
900300241 1:1973449-1973471 GGGAGGGGATGGAGGCCAGAAGG + Intronic
900375159 1:2350925-2350947 GGGAGAGGAGGGAGAGAAGGAGG - Intronic
900433286 1:2612821-2612843 AGGGTGGGATGGAGAGAAGAGGG + Intronic
900736704 1:4303694-4303716 GGAAGGGGAAGGAGAGAAAAAGG - Intergenic
900926747 1:5710750-5710772 AGGAAGGGAAGGAGGGAAGAGGG + Intergenic
900932136 1:5744126-5744148 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
900932200 1:5744286-5744308 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
900977896 1:6028538-6028560 CAGAAGGGATGGAGAGAGGGGGG - Intronic
901124450 1:6919238-6919260 CTGAGGGGATAGAGAGGTGAAGG - Intronic
901128062 1:6943198-6943220 AGGAGGGGAGGAGGAGAAGAGGG - Intronic
901196975 1:7445625-7445647 CGGAGGAGCCAGAGAGAAGAGGG + Intronic
901258988 1:7857264-7857286 GGGAGAGGAAGGAGGGAAGAGGG - Intergenic
901574961 1:10193290-10193312 CTTAGGGAATGGAGAGAAGGGGG + Intergenic
901690278 1:10968681-10968703 AGGTGGGGATGGAGAAATGACGG - Intronic
901742315 1:11350338-11350360 CCGAGGGGAGTGAGAGAAGCAGG - Intergenic
901743772 1:11359282-11359304 CGCAGGAGGTGGAGAGAGGAGGG - Intergenic
901787105 1:11632016-11632038 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
901835423 1:11921052-11921074 GGGAGGGGAGGAAGAGTAGAGGG + Intronic
902126142 1:14213311-14213333 CGGAGGGGATGGGAGGAAGAGGG - Intergenic
902128046 1:14233907-14233929 TGGAGGGGATGTAGAGAAATAGG + Intergenic
902255686 1:15187280-15187302 CGCAGGGGAGGAAGAGATGAGGG - Intronic
902649752 1:17829411-17829433 AGGAGGGCCTGGAGAGGAGATGG + Intergenic
902659861 1:17893446-17893468 GGGAGGGGATGAGGAGAAAAGGG - Intergenic
902759025 1:18568761-18568783 AGGGAGGGATGGAGAGAGGAGGG + Intergenic
902769365 1:18636766-18636788 CGGGAGGGAGGGAGAGAGGAAGG + Intronic
902908894 1:19580446-19580468 CAGAGAGGATTGAGGGAAGATGG + Intergenic
903034610 1:20485866-20485888 GGGAGGGGAGGGAGAGAGGAGGG + Exonic
903215400 1:21840982-21841004 ATGAGTGGATGGAGAGAGGAAGG - Intronic
903273644 1:22207655-22207677 AGGAGTGGAGGGAGGGAAGACGG - Intergenic
903299711 1:22370130-22370152 AGGAAGGGAAGGAGAGAGGAAGG - Intergenic
903331695 1:22600015-22600037 AGGAGGGAAGGGAGAGAAGGAGG + Intronic
903353305 1:22731035-22731057 CAGAGGGGGCGGAGAGAAAATGG + Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903369175 1:22824266-22824288 AGGAAGGGAGGGAGGGAAGAAGG + Intronic
903524125 1:23980083-23980105 GGGAGGGGACGGAGTGAAGATGG - Intronic
903763006 1:25712372-25712394 GGGAGGGTCTGGAGAGGAGATGG + Intronic
903791832 1:25898498-25898520 CGCTAGGGATGGAGAAAAGATGG - Intronic
903842436 1:26253350-26253372 TGGAGAGGATGCAGAGAAAAGGG - Intronic
903852326 1:26315580-26315602 GGGCGGGGAGGGAGAGAAGAGGG - Intronic
903996377 1:27307590-27307612 GGGAGTGGAGGGAGAGGAGAAGG - Exonic
904203872 1:28839874-28839896 AGGAAGGGAGGGAGGGAAGAAGG + Intronic
904277486 1:29393918-29393940 AGGAGGGGAGGGAGGGAGGAAGG - Intergenic
904422268 1:30402000-30402022 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
904463878 1:30696731-30696753 AGGAGAGGAGGGAGAGAGGAAGG + Intergenic
904464373 1:30699096-30699118 AGGAGAGGAGGGAGAGAGGAAGG + Intergenic
904503164 1:30929408-30929430 AGGAGGAGAGGGAGTGAAGAAGG + Intergenic
904653644 1:32025710-32025732 GGGAAGGGAGGGAGGGAAGAAGG - Intronic
904747928 1:32722483-32722505 GGGAAGGGAAGGAGAAAAGAAGG + Intergenic
904877818 1:33670151-33670173 CTGAGGGGATGGGGAGGACAAGG - Intronic
905001311 1:34671862-34671884 GGTAGAGGATGGAGAGATGATGG + Intergenic
905266159 1:36755641-36755663 TAAAGGGGAGGGAGAGAAGAAGG - Intergenic
905397134 1:37674053-37674075 GGGAGGGGATGCTGAGAGGAGGG + Intergenic
905468065 1:38170820-38170842 TGGAGGGGGTGGGGAGAAGTGGG - Intergenic
905674569 1:39816583-39816605 TGGAGGGGTTGGGGAGAAGGTGG + Intergenic
905864669 1:41370284-41370306 CAGAGAAGAGGGAGAGAAGAGGG + Intronic
905866877 1:41381532-41381554 GGGACGTGATGGAAAGAAGAGGG - Intronic
905942912 1:41878662-41878684 GGGAAGGGAGGGAGAGAGGAAGG - Intronic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906197731 1:43939287-43939309 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
906359352 1:45139436-45139458 GAGAGGGGAGGGAGAGAGGAGGG - Intronic
906710549 1:47926672-47926694 CAGAGGGGTTGGAGAGAATGGGG + Intronic
906719967 1:47997368-47997390 CGGGAGGGAGGGAGAGAGGAGGG + Intergenic
907085299 1:51666998-51667020 CAGAGAGGATGGAGACAAGTTGG + Intronic
907483436 1:54760469-54760491 CGGAGGCTGTAGAGAGAAGAGGG - Intronic
907560777 1:55385640-55385662 GGGAGGGGAGAGAAAGAAGAAGG - Intergenic
907561987 1:55399581-55399603 AGGACGGGATGGAGTGAGGAGGG + Intergenic
907569386 1:55468801-55468823 CCTAGGGGGTAGAGAGAAGAAGG + Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907859527 1:58338297-58338319 GGGAGGGGAAGGAGAGGTGAGGG - Intronic
907880835 1:58547993-58548015 CTGAGGGGATAGTGAGATGATGG - Intergenic
908259298 1:62327336-62327358 GGGAGAGAACGGAGAGAAGAAGG - Intergenic
908345596 1:63229122-63229144 GGGGAGGGATGGAAAGAAGAGGG - Intergenic
908703362 1:66925172-66925194 GGGAGGGGAAGGAGAGAAAGGGG - Intronic
909007692 1:70296760-70296782 CTGAAGGGAGGGATAGAAGAAGG + Intronic
909094831 1:71273635-71273657 TGGAGGGAATGGTGAGAAAAAGG + Intergenic
909101247 1:71352174-71352196 AGGAGGGGATGAAGAGAGGTTGG - Intergenic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
909589260 1:77327686-77327708 TGGAGGGGAGGGAGAAACGAAGG - Intronic
909779048 1:79519989-79520011 GGGAGGGGGGGAAGAGAAGAAGG + Intergenic
910020821 1:82587376-82587398 GGGATAGGATGAAGAGAAGAGGG - Intergenic
910155861 1:84218774-84218796 TGGAGGGGATGTGGAGAAAAGGG - Intronic
910369906 1:86504270-86504292 CGCAGAGGCTGGAGGGAAGAAGG - Intergenic
910474828 1:87595635-87595657 AGGAGGGAAGGGAGGGAAGAGGG - Intergenic
910855327 1:91689152-91689174 CTGAGGGGAGGGTGAGAAGAAGG - Intronic
911107138 1:94142634-94142656 TGGAGAGGAAGGAGTGAAGAGGG + Intergenic
911708593 1:101043048-101043070 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
911723517 1:101217274-101217296 CTGAGGAGATGGAGTGTAGAGGG + Intergenic
911729995 1:101282973-101282995 GGGCGAGGAGGGAGAGAAGAGGG - Intergenic
911825152 1:102474028-102474050 CAGTGGGGATAGAGAGAGGAAGG - Intergenic
912174462 1:107140052-107140074 CGGGGGGGATGGGGAGTAGAGGG + Intronic
912568747 1:110606970-110606992 CGGAGGGCACGGAGAGGAGCTGG - Intronic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
914504972 1:148281050-148281072 CGGTGGGGCGGGAGAGAGGAGGG + Intergenic
914507592 1:148303098-148303120 CGGTGGGGCGGGAGAGAGGAGGG - Intergenic
914783523 1:150807433-150807455 AGGAGGGAAGGGAGAGAAAAAGG - Intronic
914936518 1:151986009-151986031 GGGAAGGGATGGAAACAAGAAGG + Intronic
915161053 1:153921280-153921302 AGGAGGGGAAGGAGACTAGATGG + Intronic
915267392 1:154728815-154728837 CTGATGGGATTGAGAGAGGAAGG + Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915727103 1:158025714-158025736 CAAAGGAGATGGAGAGGAGAGGG + Intronic
915895405 1:159807960-159807982 GGAAGAGGAAGGAGAGAAGAAGG + Intronic
915985982 1:160465229-160465251 TGGAGAGGATGCAGAGAAAAAGG - Intergenic
916008880 1:160686395-160686417 CGGAGGGTAGGGATAGAAAATGG + Intronic
916296320 1:163224180-163224202 AGGAGGGCATGGAAAGAGGATGG - Intronic
916407401 1:164510982-164511004 CAGAGGGGAAGGTGAGAGGAAGG - Intergenic
916989421 1:170226543-170226565 AGGAAGGGAGGGAGAGAAAAGGG - Intergenic
916992740 1:170262097-170262119 AGGAGGGGGAGGAGAAAAGAGGG + Intergenic
917243312 1:172973122-172973144 AAGATGGGATGGAGAGATGATGG - Intergenic
917537236 1:175883306-175883328 CAGAGGGAAAGAAGAGAAGAGGG - Intergenic
917572403 1:176281891-176281913 GGGAGGGGAGGGAGAGAGGAAGG - Intergenic
918031307 1:180814894-180814916 GGGTGGGGATGGAGTGTAGAAGG + Intronic
918070670 1:181131538-181131560 GGGAGGGGACGGGAAGAAGAAGG + Intergenic
918087497 1:181258055-181258077 CTGAGGGGTAGGAGAGAGGACGG + Intergenic
918857754 1:189780666-189780688 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
918920918 1:190708714-190708736 AGGAGGGGAGGTAGGGAAGAAGG - Intergenic
919819504 1:201464178-201464200 GGGCGTGGCTGGAGAGAAGAGGG - Intergenic
919820299 1:201468297-201468319 AGGGAGGGAAGGAGAGAAGAGGG + Intronic
920077520 1:203348058-203348080 TGGAGGGGATGGAGAGCCGTAGG + Exonic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
920203384 1:204274615-204274637 GGGAGGGGAAGGAAAGCAGAAGG - Intronic
920210817 1:204327042-204327064 AGGAGGGGATGGAGAGAGACTGG - Intronic
920548544 1:206838795-206838817 AGGAAGGGAAGGAGAGAGGAAGG - Intronic
920637454 1:207717904-207717926 GGGATGGTAAGGAGAGAAGAGGG + Intronic
920650544 1:207834098-207834120 AGGATGTGAGGGAGAGAAGATGG - Intergenic
920721234 1:208388896-208388918 AGCTGGGGAAGGAGAGAAGATGG + Intergenic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921755111 1:218846402-218846424 TGGAGGGGATGTGGAGAAGCAGG + Intergenic
921936463 1:220801174-220801196 CAGAGGGGAGTGAGAGGAGAAGG - Intronic
922134764 1:222814275-222814297 AGAAGGGCATGCAGAGAAGAAGG - Intergenic
922505517 1:226123376-226123398 GGGAGGGCCTGGAGAGGAGAGGG - Intergenic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
922595904 1:226812697-226812719 AGGGAGGGAGGGAGAGAAGAAGG - Intergenic
922660833 1:227429153-227429175 GGGAGGGGATGGGGAGAGGTGGG - Intergenic
922820785 1:228484063-228484085 AGGAGTGGAGGGAGAGAGGAAGG - Intergenic
923029257 1:230234276-230234298 TGGAGGGGGTGGGGAGGAGAAGG + Intronic
923081607 1:230662020-230662042 AGGAGAGGAGGGAGAGGAGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923452866 1:234136175-234136197 AGGAGGGAAGGGAGGGAAGAAGG - Intronic
923482447 1:234397458-234397480 GGGAGGGGAAGGAGGGAGGATGG + Intronic
923602058 1:235412129-235412151 GGGAGGGGAAGGGGAGGAGAAGG - Intronic
924257386 1:242195935-242195957 GTGAGGGGCTGAAGAGAAGAGGG + Intronic
924287273 1:242500675-242500697 GGGAAGGGAAGAAGAGAAGAAGG + Intronic
924460548 1:244254858-244254880 CAGAGAGAATGGAGAGAAGGAGG - Intergenic
1062975029 10:1676845-1676867 TGAAGAGGATGGAGAGAAGGTGG + Intronic
1063038614 10:2314760-2314782 CTCAGGGGATAGAGAGAAGAGGG + Intergenic
1063078590 10:2742255-2742277 CGGAGAGAGTGCAGAGAAGAGGG - Intergenic
1063090075 10:2857078-2857100 GGGAGGGAAAGGAGAGAGGAGGG + Intergenic
1063180689 10:3596352-3596374 AGGAGGGAAGGGAGAGAAGAGGG + Intergenic
1063186510 10:3656859-3656881 GGGAGGGGATGGTGAGGAGGGGG + Intergenic
1063365345 10:5487083-5487105 GGGAGGGGAAGCAGAGAGGAAGG - Intergenic
1063407810 10:5813445-5813467 AGGAGGGGAGGGAGCGAGGAGGG + Exonic
1063493943 10:6489705-6489727 GGCAGGGGAGGGAGAGGAGAGGG + Intronic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1064114771 10:12568337-12568359 AGGAGGGGAGGGGGAGAGGAGGG - Intronic
1064826631 10:19410625-19410647 AGGAGGGGAGGGAGGGAGGAAGG - Intronic
1065169353 10:23011008-23011030 GGGAAGGGAAGGAGAGAGGAGGG - Intronic
1065501787 10:26390530-26390552 CGGAGGGGATGAAGAGAGGTTGG + Intergenic
1065530608 10:26666087-26666109 AGGAAGGGATGGAAAGAAGGGGG + Intergenic
1065534556 10:26704436-26704458 GGGAAGGGATGGACTGAAGATGG + Intronic
1065608512 10:27446615-27446637 AGGAGGAGAAGGAAAGAAGAAGG - Intergenic
1065667862 10:28082416-28082438 AGGAGGAGAAGGAGAGAAGGAGG - Intronic
1065780227 10:29160397-29160419 CAGAGGGGTAGGAGAGAGGAGGG + Intergenic
1066021066 10:31302723-31302745 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1067083212 10:43223853-43223875 AGAAAGGGAGGGAGAGAAGAAGG + Intronic
1067216893 10:44310889-44310911 CGGAGGGGAAGGTGAGAACCCGG + Intergenic
1067359310 10:45563018-45563040 GGGAGGGGAAGGAGAGAGGAAGG - Intronic
1067527604 10:47047908-47047930 TGGAGGTGATGTAGTGAAGACGG - Intergenic
1068329239 10:55539039-55539061 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
1069436956 10:68393009-68393031 TTGAGGGGATAGAGAGAAAATGG - Intronic
1069567185 10:69471575-69471597 AAGAGGGGAGGGAGAGAAGGTGG - Intronic
1070065312 10:73027835-73027857 AGGAAGGGAGGGAGAGAGGAGGG + Intronic
1070161125 10:73867385-73867407 CGGGGGGCATGGAGAACAGACGG - Intronic
1070163710 10:73881938-73881960 TGGAGGGGAGGGGGTGAAGAGGG + Intergenic
1070609087 10:77921285-77921307 CAGAGGGGATGAAGAAAAGGTGG + Intronic
1070976417 10:80609334-80609356 CAGAGGGGAAGGAAAGAGGAAGG - Intronic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071485640 10:86100547-86100569 CAGAGAGGAGGGAGAGAAAATGG + Intronic
1071534707 10:86418530-86418552 CGGAGGGGAGGAAGGAAAGAAGG + Intergenic
1072100730 10:92226869-92226891 GGGAAGGGATGGAGGGAACAGGG + Intronic
1072550270 10:96472025-96472047 AGGAGGGGGTCCAGAGAAGAAGG - Intronic
1072910762 10:99498837-99498859 CGAAGGGAATGGAGAGGAGAAGG - Intergenic
1072937187 10:99724535-99724557 GGGAGGGTATGGAAAGAGGAGGG - Intronic
1072975523 10:100054205-100054227 TGGGGGGGATGGAGGAAAGAAGG - Intronic
1073064090 10:100748286-100748308 GGGAGGGGAGGGTGAGAAGTGGG + Intronic
1073070887 10:100792569-100792591 AGCAGAGGATGGGGAGAAGAGGG + Intronic
1073113142 10:101074510-101074532 CAGCGGGGATGGAAAGGAGAGGG + Intergenic
1073122459 10:101131171-101131193 GGGAGGGGAGGGGGAGAGGAAGG - Exonic
1073218094 10:101847798-101847820 CAGCAGGGAAGGAGAGAAGAGGG + Intronic
1073340931 10:102744046-102744068 GGAGGGGGATGGAGAGGAGAAGG + Exonic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073361433 10:102902524-102902546 AGGAAGGGAAGGAGAGAGGAAGG + Intergenic
1073602400 10:104859927-104859949 TGGAGAGGATGTAGAGAAGTAGG + Intronic
1073662650 10:105493877-105493899 AGGAAGGGAAGGAGGGAAGAAGG + Intergenic
1074293551 10:112160259-112160281 AAGAGAGGAAGGAGAGAAGAGGG - Intronic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1074660273 10:115647432-115647454 CGGAGAGGATGTAGAGAAATAGG - Intronic
1075006703 10:118835852-118835874 AGGTGGGGAGGGAGAGGAGATGG - Intergenic
1075057669 10:119231839-119231861 CGGAGACGATGTAGAGAAAAGGG + Intronic
1075065596 10:119287147-119287169 AGGGAGGGAAGGAGAGAAGAAGG + Intronic
1075256361 10:120928758-120928780 CGGAAGGGAGGGAGAGAGGGAGG - Intergenic
1075301715 10:121330643-121330665 AGGAAGGGAGGGAGAGAAAATGG - Intergenic
1075380843 10:122017358-122017380 AGGGAGGGAGGGAGAGAAGATGG - Intronic
1075667107 10:124239456-124239478 GGGAGGGGAGGGAGAAAGGAAGG + Intergenic
1076004594 10:126938755-126938777 CGGAGGGGATGAAGACAGGAGGG + Intronic
1076004607 10:126938803-126938825 CGGAGGGGATGAACACAGGAGGG + Intronic
1076004695 10:126939091-126939113 CGGAGGGGATGAACACAGGAGGG + Intronic
1076048344 10:127312822-127312844 TGGAAGGGAGGGAGAGAAGGAGG - Intronic
1076169820 10:128309815-128309837 GGGAGGCCATGGAGAGAAGCAGG + Intergenic
1076242975 10:128923883-128923905 AGCAGAAGATGGAGAGAAGACGG - Intergenic
1076364023 10:129910657-129910679 GGGAGGTGATGGGGAAAAGAAGG - Intronic
1076509043 10:130999314-130999336 TGGAAGGGAGGGAGAGAGGACGG + Intergenic
1076738315 10:132468472-132468494 GGGAGGAGATGGGGAGGAGATGG + Intergenic
1076811172 10:132887215-132887237 GGGAGAGGAGAGAGAGAAGAGGG - Intronic
1076811216 10:132887460-132887482 AGGAGAGGAGAGAGAGAAGAGGG - Intronic
1076811261 10:132887733-132887755 GGGAGAGGAGAGAGAGAAGAGGG - Intronic
1076811306 10:132887992-132888014 GGGAGAGGAGAGAGAGAAGAGGG - Intronic
1076811314 10:132888030-132888052 GGGAGAGGAGAGAGAGAAGAGGG - Intronic
1077081228 11:725597-725619 CGGAGAGAATGGAGCGAAGCGGG + Intronic
1077283168 11:1754521-1754543 TGGAGGGGATGGAGGGATGGAGG + Intronic
1077283178 11:1754546-1754568 TGGAGGGGATGGAGGGATGGAGG + Intronic
1077287742 11:1775317-1775339 GAGGGGGGATGGAGAGGAGATGG + Intergenic
1077287754 11:1775351-1775373 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287758 11:1775362-1775384 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287760 11:1775373-1775395 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287768 11:1775395-1775417 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287770 11:1775406-1775428 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287776 11:1775428-1775450 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287793 11:1775473-1775495 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287797 11:1775484-1775506 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287801 11:1775495-1775517 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287803 11:1775506-1775528 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287811 11:1775528-1775550 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287813 11:1775539-1775561 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287825 11:1775573-1775595 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287829 11:1775584-1775606 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287831 11:1775595-1775617 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287839 11:1775617-1775639 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287841 11:1775628-1775650 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287847 11:1775650-1775672 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287862 11:1775695-1775717 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287889 11:1775762-1775784 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287893 11:1775773-1775795 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287897 11:1775784-1775806 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287910 11:1775818-1775840 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287914 11:1775829-1775851 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287926 11:1775863-1775885 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287928 11:1775874-1775896 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287936 11:1775896-1775918 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287940 11:1775907-1775929 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287942 11:1775918-1775940 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287959 11:1775963-1775985 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287963 11:1775974-1775996 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287967 11:1775985-1776007 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287969 11:1775996-1776018 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287977 11:1776018-1776040 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287984 11:1776041-1776063 AGAGGGGGATGGAGAGGAGATGG + Intergenic
1077287992 11:1776063-1776085 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287996 11:1776074-1776096 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288000 11:1776085-1776107 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288002 11:1776096-1776118 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077288010 11:1776118-1776140 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288017 11:1776141-1776163 AGAGGGGGATGGAGAGGAGATGG + Intergenic
1077288028 11:1776175-1776197 AGAGGGGGATGGAGAGGAGATGG + Intergenic
1077288036 11:1776197-1776219 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288043 11:1776220-1776242 AGAGGGGGATGGAGAGGAGATGG + Intergenic
1077288051 11:1776242-1776264 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288058 11:1776265-1776287 AGAGGGGGATGGAGAGGAGATGG + Intergenic
1077288066 11:1776287-1776309 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077479334 11:2806295-2806317 GAGAGGGGAGGGAGAGAGGAAGG + Intronic
1077556792 11:3229911-3229933 GGGAGGGGATGGAGGGAGGCTGG - Intronic
1077664821 11:4098369-4098391 GGGAGGGGAGGGAGGGAGGAGGG - Intronic
1077923199 11:6656148-6656170 AATAGGGGATGGAAAGAAGATGG - Intergenic
1078000148 11:7487312-7487334 CGGAGGGGTAGGAAAAAAGAGGG + Intronic
1078108163 11:8371724-8371746 AGGGAGGGAGGGAGAGAAGAAGG - Intergenic
1078315161 11:10288760-10288782 AGCAGAGGATGGAGAGATGATGG - Intronic
1078396958 11:10989608-10989630 CGGACATGATGGAGTGAAGATGG - Intergenic
1078465335 11:11546055-11546077 CTGAGTGGCTGGGGAGAAGAGGG - Intronic
1078476290 11:11633124-11633146 GGGGCGGGATAGAGAGAAGATGG + Intergenic
1078923658 11:15854493-15854515 AGGAGGGGAGGGAAGGAAGAGGG + Intergenic
1079010305 11:16822638-16822660 TGAAGGAGATGAAGAGAAGATGG - Intronic
1079029731 11:16977558-16977580 CTGAGGGGATATGGAGAAGAGGG - Intronic
1079133446 11:17762811-17762833 GGGTGGGAATGGAGAGACGAAGG - Intronic
1079169700 11:18081136-18081158 AGGAGGGGAGGGAGAGAGGGAGG - Intronic
1079189357 11:18265016-18265038 AGGAAGGGAGGAAGAGAAGAAGG + Intergenic
1079432368 11:20405084-20405106 GGGAAGGGATGGAGAGAGAAGGG - Intronic
1079733268 11:23962328-23962350 CTGAGAGGATGGAGAGACAACGG + Intergenic
1080036452 11:27717676-27717698 AGAAGGTGATGGAGAGAAGAAGG - Intronic
1080661065 11:34296314-34296336 AGGAGGGGAGGGAGACAAGGAGG + Intronic
1080956331 11:37099969-37099991 AGGAAGGGATGGAGGGAGGAAGG - Intergenic
1081261523 11:40967170-40967192 AGGAAGGGATGGAGGGAGGAAGG + Intronic
1081651818 11:44828880-44828902 GGGTCGTGATGGAGAGAAGAGGG - Intronic
1081749547 11:45500118-45500140 TGTTGGGGATGTAGAGAAGATGG + Intergenic
1081878545 11:46428191-46428213 GGGAGGGGAAGAAGAGGAGAGGG + Intronic
1082785618 11:57314678-57314700 GGGAGGACGTGGAGAGAAGAGGG + Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1082901150 11:58254094-58254116 TGGTGAGGATGCAGAGAAGAGGG - Intergenic
1082986379 11:59173491-59173513 CGGAGCAGATGGAGAGAGGAGGG + Intronic
1083224658 11:61277066-61277088 TGGAGGGAAGGGAGAGAGGAAGG + Intronic
1083427905 11:62598459-62598481 CGTAGAAGATGGAGAGAAGGAGG - Intronic
1083576145 11:63793252-63793274 CAAAGGGGAAGGAGAGAAGAAGG - Intergenic
1083651596 11:64207704-64207726 CAGAAGGGAGGGAGGGAAGAGGG - Intronic
1083687999 11:64388840-64388862 AGCAGGGGATGCAGAGAGGATGG + Intergenic
1083743379 11:64722691-64722713 GGGAAGGGATGGAGAGAGGAGGG - Intronic
1083853006 11:65378807-65378829 AGGGGTGGATGGAGGGAAGAGGG - Intronic
1083912471 11:65718293-65718315 GGCAGGGGATGCAGAGAAAATGG - Exonic
1084476079 11:69390558-69390580 AGGAGGGGAGGGAGAGGAGGAGG + Intergenic
1084794023 11:71492125-71492147 GGGAGGGGAGGGAGAGCAGATGG + Intronic
1084805460 11:71575889-71575911 CAGAGGGGATGCAGTGCAGACGG + Intergenic
1084863927 11:72040817-72040839 TAAAGGGGAGGGAGAGAAGAGGG - Intronic
1084907966 11:72363204-72363226 GGGAGGGGACGGAGGGAAGGAGG + Intronic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085472393 11:76766700-76766722 CAGGGAGGATGGAGAGGAGACGG - Intergenic
1086030750 11:82352224-82352246 CGGAGAGGATGTAGAGAAACAGG - Intergenic
1086295152 11:85358104-85358126 CAGAAGGGAAGAAGAGAAGAAGG + Intronic
1086873884 11:92072531-92072553 AGGAGGGGTTGGAGCCAAGATGG + Intergenic
1086889965 11:92246124-92246146 GGCAGTGGATGGAGTGAAGAGGG + Intergenic
1087163763 11:94977259-94977281 TGGATGGGATTGAGAGAAAAGGG + Intronic
1087252894 11:95923819-95923841 CGAAGGGGATGGAGAGGGGCCGG - Intronic
1087474804 11:98622073-98622095 AGGAGGGGAGGGAGAGGAGGGGG - Intergenic
1088524221 11:110735233-110735255 AGGAGGGGAGGAGGAGAAGAAGG + Intergenic
1088537226 11:110874440-110874462 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1088570563 11:111219596-111219618 GGGAGGGGAGGGGGAGGAGAGGG - Intergenic
1088695171 11:112360274-112360296 ATGATGGGATGGAGAGAACATGG + Intergenic
1088771547 11:113040838-113040860 CAGAAGGGATGAAGAGTAGAAGG - Intronic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089162740 11:116452086-116452108 GGGAGGGGATTGAGAGAAGATGG - Intergenic
1089196309 11:116695845-116695867 AGGAGGGGAAGGAGGGAAGGAGG - Intergenic
1089223932 11:116899623-116899645 AGTAGGAGAGGGAGAGAAGAAGG - Intronic
1089316708 11:117596451-117596473 AGGAGGAGAGAGAGAGAAGAGGG + Intronic
1089410369 11:118236376-118236398 AGGAAGGGAGGGAGAGAAGGAGG + Intronic
1089747739 11:120628861-120628883 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
1090062629 11:123477270-123477292 GGGAGGGGAGGGAGAGGGGAGGG - Intergenic
1090153056 11:124405296-124405318 CTTGGGGGAGGGAGAGAAGAGGG - Intergenic
1090475085 11:127013040-127013062 AGGGAGGGATGGAGAGAGGAAGG + Intergenic
1090623585 11:128585298-128585320 GGGAGGGAAGGGAGGGAAGAAGG + Intronic
1091121312 11:133060219-133060241 CTGAGGGGATGGGGAGAAGGAGG - Intronic
1091192593 11:133707411-133707433 TGGAGGGGAAGGGGAGAGGAAGG + Intergenic
1091376944 12:31286-31308 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1091423001 12:359780-359802 AGGAAGGGATGAAGGGAAGAAGG + Intronic
1091770622 12:3148879-3148901 AGGAGGGGATGAGGAGAAGAGGG + Intronic
1091837940 12:3599057-3599079 AGGAGGGGAGGGAGAGATGGAGG + Intergenic
1092762135 12:11819740-11819762 CAGAAGGGATGGAGAAAGGATGG - Intronic
1093028831 12:14269495-14269517 CAAAGTGGATGGAGAGAATAAGG + Intergenic
1094083738 12:26566041-26566063 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083745 12:26566079-26566101 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094457560 12:30654710-30654732 TGGAGGGGATGTAGAGAAAAAGG + Intronic
1094584703 12:31767424-31767446 AGGAGGGGAGGGAGAGAAAGAGG + Intergenic
1096602159 12:52737040-52737062 CACAGAGGATGGAGAGATGAAGG - Intergenic
1096602899 12:52742693-52742715 CACAGAGGATGGAGAGATGAGGG + Intergenic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1096761497 12:53845533-53845555 GGGAGGGGTTGGGGAGGAGAGGG + Intergenic
1096806265 12:54143016-54143038 AGGAGGGGTTGGAGAGAGGTGGG + Intergenic
1096843006 12:54390665-54390687 CAGAGGGGCTGGGGAGAAGAGGG - Intronic
1098298141 12:69025323-69025345 TGGAGGAGATGGAGATAAGCAGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098599438 12:72312966-72312988 GGGAAGGGAGGGAGAGAGGAAGG - Intronic
1098671711 12:73238333-73238355 AGGAAAGGATGGAGAGAAGTTGG + Intergenic
1098917432 12:76272156-76272178 CTGAGGGGAGGGAGAAGAGACGG - Intergenic
1098918818 12:76284186-76284208 AGGAAGGGAGGGAGAGAAGAAGG + Intergenic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099600333 12:84727711-84727733 TGGAGAGGATAGAGAGAAGCTGG - Intergenic
1099693429 12:85991250-85991272 AGGAGAGGATGGAGAGATGATGG - Intronic
1100065715 12:90641497-90641519 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1100263052 12:92950642-92950664 AGGAAGAGAGGGAGAGAAGAGGG + Intergenic
1100287868 12:93184507-93184529 GGGTGGGGATGGAGAGAGAAAGG + Intergenic
1100370789 12:93966995-93967017 AGGGAGGGATGGAGAGATGAAGG - Intergenic
1100441116 12:94617774-94617796 GGGGTGGGATGGAGAGAAAAGGG + Intronic
1100569749 12:95836956-95836978 GGGAGGAGATGGAGAGGAGAGGG + Intergenic
1100569866 12:95837440-95837462 CGGAGAGGGAGGAGAGAAGGTGG + Intergenic
1100602087 12:96120740-96120762 AGGAAGGGAGGGAGAGAGGAAGG + Intergenic
1100643257 12:96503035-96503057 AGGAAGGGAGGGAGAGAGGAAGG - Intronic
1100643908 12:96509197-96509219 AGAAGGGGATAGAGAGAGGAGGG + Intronic
1100877192 12:98975004-98975026 GGGAGGGGAGGGAGGGAGGAAGG - Intronic
1101141285 12:101798307-101798329 AGGAGGGCATGTAGAGTAGAAGG - Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101348287 12:103905626-103905648 AGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1101557470 12:105823886-105823908 CGGAGGGGTTTCAGAGATGAGGG - Intergenic
1101709572 12:107252683-107252705 AGGAAGGGAAGGAGAGAAGGAGG - Intergenic
1102131166 12:110529869-110529891 AGGAGGGGAAGGGAAGAAGATGG + Intronic
1102227285 12:111237707-111237729 GGCAGGGGCTGGAGAGCAGATGG - Intronic
1102501014 12:113352485-113352507 GGGAGGGGAGGGAGAGAGGGAGG - Intronic
1102900052 12:116629387-116629409 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1102901997 12:116646167-116646189 TGGTGGGGGAGGAGAGAAGAAGG + Intergenic
1103030106 12:117606344-117606366 AGGAGGGGAGGGAGGGAGGAAGG - Intronic
1103030115 12:117606364-117606386 AGGAGGGGAGGGAGGGAGGAAGG - Intronic
1103030131 12:117606404-117606426 AGGAGGGGAGGGAGGGAGGAAGG - Intronic
1103030140 12:117606424-117606446 AGGAGGGGAGGGAGGGAGGAAGG - Intronic
1103030149 12:117606444-117606466 AGGAGGGGAGGGAGGGAGGAAGG - Intronic
1103030165 12:117606484-117606506 AGGAGGGGATGGAGGAAGGAAGG - Intronic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103255819 12:119540540-119540562 TTGAGGGGAGGGAGAGAAGGTGG + Intronic
1103367023 12:120390801-120390823 AGGAAGGGAGGGAGAGAAGAAGG + Intergenic
1104248157 12:127062579-127062601 GGGAGGGGATGGATGGAAGGAGG - Intergenic
1104544468 12:129698661-129698683 GGGAGGGGAGGGGGAGGAGATGG + Intronic
1104647373 12:130506778-130506800 CGGAAGGGATGGAGACAAGGAGG + Intronic
1105007316 12:132729483-132729505 GGGAGGGGAAGGTGAGAGGAGGG + Intronic
1105546629 13:21355486-21355508 GGGAGGGGAAGGAGAGAGCAGGG + Intergenic
1105678380 13:22700774-22700796 GGGAGGGGATGCATATAAGAAGG - Intergenic
1106116782 13:26824551-26824573 CGAAAGGGAGGAAGAGAAGAAGG - Intergenic
1106441712 13:29779957-29779979 TGGAGGGCAGGAAGAGAAGAGGG - Intronic
1106539610 13:30678199-30678221 GGGAGGGGATGGGCAGAAGTTGG + Intergenic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1106670428 13:31899020-31899042 AGGATGGGATGGAGAGAGGTAGG - Intergenic
1106692866 13:32137348-32137370 TGGAGGGGATAGAGAAAGGATGG - Intronic
1106969969 13:35127524-35127546 GGGAGGGGACTGAGAAAAGAAGG + Intronic
1107787743 13:43971512-43971534 TGGAGGGGCTGGAGAGGGGAAGG + Intergenic
1107819955 13:44277322-44277344 CGGAAGGGAAGGGGAGAGGAGGG + Intergenic
1107851667 13:44577415-44577437 CGGAGGAGGAGGAGGGAAGATGG + Intergenic
1107890982 13:44914223-44914245 CGGCGGGGAGGGGTAGAAGACGG + Intergenic
1108333195 13:49411443-49411465 GGGAGGGGAATTAGAGAAGAGGG - Intronic
1108489153 13:50962930-50962952 CTGAGGGGATAGGGAGAAAAGGG - Intronic
1108645333 13:52421380-52421402 AGGAGGGGATGGAGAGAGGTTGG + Intronic
1108697049 13:52911631-52911653 TAGAGGGTATGCAGAGAAGAAGG + Intergenic
1108845892 13:54678231-54678253 CTGAGGGGTTGGAGAGAGGGAGG - Intergenic
1108986132 13:56590041-56590063 AGGAAGGGAGGGAGAGAGGAAGG + Intergenic
1109119472 13:58435998-58436020 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1110227100 13:73131175-73131197 TTGAGGGGAAGGAGAGAATATGG + Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110596622 13:77326935-77326957 CGGGGGGGAGGAGGAGAAGAAGG - Intronic
1110641526 13:77830203-77830225 AGGGGGGGAGGGAGGGAAGAAGG - Intergenic
1111017872 13:82404756-82404778 TGGAGAGGATGCGGAGAAGAAGG + Intergenic
1111288717 13:86131980-86132002 TGGAGAGGATGCAGAGAAAAAGG - Intergenic
1111788349 13:92820009-92820031 CAGAGAGGAAGCAGAGAAGAGGG - Intronic
1111897422 13:94158544-94158566 CAGAGGGGAAGGACAGAAGCAGG + Intronic
1111930044 13:94503386-94503408 GGGAAGGGAAGGAGAGGAGAGGG + Intergenic
1112002596 13:95225099-95225121 TGGGGGAGAGGGAGAGAAGAAGG - Intronic
1112225356 13:97534229-97534251 CGCAGGGGATGGTGAGGAGCAGG - Intergenic
1112566800 13:100558836-100558858 GAGAGGGGATGGAGAGAGGTTGG + Intronic
1112817308 13:103288024-103288046 GGGATGGGATGTAGATAAGAAGG - Intergenic
1112849547 13:103688153-103688175 AGGAGGGGATAGAGAGAAGTTGG - Intergenic
1113090806 13:106616185-106616207 TGGAGAGGATGTAGAGAAAAGGG - Intergenic
1113140947 13:107148490-107148512 AGGAGGGGAAGGAGAGAAAAAGG + Intergenic
1113508909 13:110836165-110836187 AGGGAGGGAGGGAGAGAAGAAGG + Intergenic
1113663042 13:112120113-112120135 AGGAAGGGAGGGAGAGAGGAAGG + Intergenic
1113754740 13:112803698-112803720 AGGAGGGGAATGAGAGAAGGAGG - Intronic
1113754754 13:112803741-112803763 AGGAGGGGAATGAGAGAAGGAGG - Intronic
1113909731 13:113836364-113836386 GGGAGAGGATGGAGAGGAGGGGG + Intronic
1113975665 13:114225620-114225642 GGGAGGGGAGGGAGAAGAGAAGG + Intergenic
1114240773 14:20865618-20865640 TGGAGAGGATGCAGAGAAGTAGG + Intergenic
1114374115 14:22124408-22124430 AGGAAGGGAAGGAGAGAAGGAGG + Intergenic
1114773553 14:25455940-25455962 GGAAGGGGAAGGAGAGAAGGAGG - Intergenic
1114877991 14:26747178-26747200 CGGTGAGGATGTAGAGAAAAAGG + Intergenic
1115399597 14:32941251-32941273 GGGAGGGGAAGGAGGGAGGAGGG - Intronic
1115695224 14:35890607-35890629 AGGAGGGGATGAAGAGAGGTTGG - Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116747292 14:48836886-48836908 GGGAGGGGAGGGAGTGAAGAGGG - Intergenic
1116810177 14:49532324-49532346 TGGAGAGGATGTAGAGAAAAGGG + Intergenic
1117124991 14:52613483-52613505 TGGAGGGGTTGGGGAGAAGTGGG - Intronic
1117280271 14:54233874-54233896 AGGAGGGGCTGGAGCCAAGATGG + Intergenic
1117429571 14:55642328-55642350 GGCAGGGGATGGAGATGAGATGG - Intronic
1117561177 14:56940698-56940720 TGGAGTGGAGGGTGAGAAGATGG - Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117660589 14:58000325-58000347 AGGCTGGGATGGAGAGAAAAGGG - Intronic
1117732708 14:58739911-58739933 AGGAGAGGATGGTGGGAAGAAGG + Intergenic
1117949978 14:61073019-61073041 CGGAGAGGATGTGGAGAAAAGGG - Intronic
1117985038 14:61378834-61378856 TAGAAGGGATGGAGAGGAGAGGG - Intronic
1118979089 14:70701657-70701679 AGGAGGGGATGAGGAGGAGAAGG + Intergenic
1119551342 14:75516165-75516187 AGGAGGGGAAGGAGGGAGGAAGG - Intergenic
1119726379 14:76924210-76924232 CGGTGGGGAGGGGGAGAAGGGGG + Intergenic
1119922194 14:78456916-78456938 AGGAAGGGAGGGAGAGAGGAAGG - Intronic
1119963484 14:78886447-78886469 AGGAAGGGAGGAAGAGAAGAAGG - Intronic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121741802 14:96257902-96257924 AGGATGGGAGGGAGGGAAGAAGG + Intronic
1121994400 14:98591042-98591064 TGGCGGGGATGGAGAGAAAGCGG - Intergenic
1122031238 14:98914182-98914204 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1122211661 14:100177901-100177923 CGGCGGGGGTGGGGAGAGGAGGG + Intergenic
1122359457 14:101150899-101150921 AGGAAGGGAGGGAGAGAGGAGGG - Intergenic
1122401095 14:101467862-101467884 TGGGGAGGATGGAGAGAAGAGGG + Intergenic
1123483020 15:20653225-20653247 GGGAGAGGATTGAGAAAAGAAGG - Intergenic
1123799737 15:23807452-23807474 AGGAGGGGAAGGAGAGAGGGAGG + Intergenic
1124103292 15:26715055-26715077 CTGAGGGCATGCAGACAAGAGGG + Intronic
1124209780 15:27753311-27753333 CGGAGGGGAGTGGGAGAAGGGGG + Intergenic
1124957749 15:34370836-34370858 GGGAGGGGATGAAGAGGAGGAGG - Intergenic
1125477707 15:40058624-40058646 CTCAGGGGAAGGAGAGGAGAGGG + Intergenic
1125517878 15:40332975-40332997 GGGATGGGATGGAGTGAAGGGGG - Intronic
1126167644 15:45667057-45667079 AGGAAGGGAGGGAGAGAGGAAGG - Intronic
1126405599 15:48319620-48319642 TAAAGGGGAAGGAGAGAAGAGGG + Intergenic
1126434232 15:48619453-48619475 AGGAAGGGAGGGAGAGAAGGAGG - Intronic
1126438407 15:48660386-48660408 CAGAGAGGAGGGAGAGATGAAGG + Intergenic
1126542571 15:49839349-49839371 CGGGGGGGGTGGAGCCAAGATGG - Intergenic
1127045971 15:55026033-55026055 TGGAGTGGGTGGAAAGAAGAAGG - Intergenic
1127492703 15:59480047-59480069 TGGTGGAGATGGGGAGAAGATGG + Intronic
1127672239 15:61206246-61206268 AGGAAGGGAGGGAGAGAGGAAGG + Intronic
1127697340 15:61463278-61463300 GGGAGGTGCTGGAGAGGAGATGG - Intergenic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128179764 15:65591728-65591750 AGGACTAGATGGAGAGAAGACGG + Exonic
1128514827 15:68335655-68335677 GGGCCGGGATGGAGGGAAGAGGG - Intronic
1128650933 15:69413162-69413184 CAGAGGGGTGGGAGACAAGAGGG + Intergenic
1128782798 15:70374141-70374163 TGGAGGGGATGGAGAGGTGGGGG - Intergenic
1128982587 15:72197933-72197955 AGGTGGGGAAGGAGAGAAGCTGG - Intergenic
1129521509 15:76189347-76189369 AGGAGGGGAGGGAGGGAGGAAGG + Intronic
1129599444 15:76989753-76989775 GGCAGGGGCTGGAAAGAAGAGGG - Intergenic
1129832792 15:78681664-78681686 TAGAGGGGAGGGAGAGATGAGGG + Intronic
1129933020 15:79428172-79428194 GGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1129933062 15:79428298-79428320 AGGAAGGAAGGGAGAGAAGAAGG - Intergenic
1129935856 15:79449803-79449825 TGGTAGGGATGGAGAGAAGGAGG - Intronic
1130533552 15:84766539-84766561 GAGAGGGGAAGGAGAGAAGAGGG + Intronic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1130839216 15:87682050-87682072 AGGGAGGGATGGAGGGAAGAAGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130941264 15:88511230-88511252 TGGAGGGAATAGAGAGTAGAGGG - Intergenic
1131009391 15:89004603-89004625 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1131343656 15:91626709-91626731 CTAAGGGGATGAAGAGAGGAGGG + Intergenic
1131361181 15:91792068-91792090 CAAAGGGGATGGAGGGAGGAGGG - Intergenic
1131508246 15:93034556-93034578 CGGAAGAGAGGGAGGGAAGAGGG + Intergenic
1131588530 15:93722423-93722445 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1131649863 15:94387091-94387113 AGGAGAGGAAGGAGAGAAAAAGG - Intronic
1132003089 15:98199856-98199878 TGGAGTGGATAGAGAGAACAAGG - Intergenic
1132020417 15:98356557-98356579 AGGAAGGGATGGAGAGAGGAAGG + Intergenic
1132238914 15:100242540-100242562 GGGAGAGGATGGAGAGAGGAGGG - Intronic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1132449976 15:101961708-101961730 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
1132918053 16:2364776-2364798 AGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1133158470 16:3892590-3892612 AGGAAGGGAGGGAGAGATGAGGG - Intergenic
1133395829 16:5446751-5446773 CGGTGGGGATGGACAGGAGGAGG - Intergenic
1133460719 16:5984106-5984128 GGGAGGGGAAGGAGAGGAGGAGG - Intergenic
1133460730 16:5984132-5984154 GGGAGGGGAAGGAGAGGAGGAGG - Intergenic
1133460753 16:5984181-5984203 GGGAGGGGAAGGAGAGGAGGAGG - Intergenic
1133517448 16:6523244-6523266 AGGAGGGAAGGAAGAGAAGAAGG + Intronic
1133559872 16:6941225-6941247 GGGAGGGGATGGAGGGAGGGAGG - Intronic
1133702548 16:8322595-8322617 ATGAAGGGATGGAGAGAAGGTGG - Intergenic
1133839289 16:9394109-9394131 TGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1133839491 16:9394724-9394746 AGGAAGGGAGGGAGAGAGGAAGG - Intergenic
1134167360 16:11941363-11941385 GGGAGGGGAAGGGGAGAGGAAGG + Intronic
1135058299 16:19249379-19249401 GGGAGGGGATGGAGTGGAAAGGG + Intronic
1135200751 16:20436142-20436164 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
1135613265 16:23887342-23887364 CGGAAAGGAGGGAGAGAAGGGGG - Intronic
1136081296 16:27854188-27854210 AGGAGGGGAAGGGGAGAGGAAGG + Intronic
1136095863 16:27955963-27955985 AGGGAGGGAGGGAGAGAAGAAGG + Intronic
1136170054 16:28483679-28483701 AGGAAGGGAGGGAGAGAAGAAGG - Intronic
1136589013 16:31206055-31206077 AGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1136667468 16:31824810-31824832 CCGAGAGTTTGGAGAGAAGAAGG + Intergenic
1136730343 16:32405933-32405955 GGGAAGGGATGAAGGGAAGAAGG - Intergenic
1137373842 16:47933458-47933480 AGGAAGGGATGGAGGGAGGAAGG + Intergenic
1137570910 16:49565867-49565889 AGGAGAGAATGGAGAGGAGAGGG + Intronic
1137578187 16:49617706-49617728 GGGAGAGGAGGGAGAGAAGTGGG - Intronic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138498400 16:57423071-57423093 GGGAAGGGATGGAGAGAGGAAGG + Intergenic
1138667719 16:58586307-58586329 GGGAGGGGAAGGGGAGGAGAGGG + Intronic
1138921504 16:61535647-61535669 GGGAGGGGGAGGAGAGGAGAGGG + Intergenic
1139028996 16:62855931-62855953 AGGGAGGGAAGGAGAGAAGAAGG + Intergenic
1139209988 16:65067877-65067899 AGGAAGGGAGGGAGAGAGGAAGG + Intronic
1139210021 16:65067981-65068003 AGGAAGGGAGGGAGGGAAGAAGG + Intronic
1139303137 16:65962068-65962090 AGGCAGGGAGGGAGAGAAGAAGG + Intergenic
1139310724 16:66025881-66025903 TGCAGGGGAGGGAGAGAGGAAGG + Intergenic
1139684304 16:68590776-68590798 AGGAGGGAAGGGAGAAAAGAAGG - Intergenic
1139944162 16:70627422-70627444 CGGAGGGGGAGGGGAGAGGAGGG - Intronic
1140914621 16:79482969-79482991 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1140914673 16:79483104-79483126 GGGAGGGGAGGGAGGGAAGTAGG - Intergenic
1140914716 16:79483205-79483227 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141265567 16:82493877-82493899 CAAAGAGGAAGGAGAGAAGAGGG - Intergenic
1141355211 16:83339108-83339130 TGAGGGGGATGGAGAGAAAAGGG + Intronic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141584127 16:85021775-85021797 AGGAGAGGAGAGAGAGAAGAGGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141930643 16:87200239-87200261 TGGAGGGGATGTAGAGTGGATGG - Intronic
1142142126 16:88477154-88477176 AGGAGAGGAGGGAGAGAAGCGGG + Intronic
1142142672 16:88479542-88479564 CGGTGGGGACAGAGAGGAGACGG - Intronic
1142254335 16:89006728-89006750 GGGAGGGGAGGGGGAGGAGATGG - Intergenic
1142254360 16:89006789-89006811 GGGAGGGGAGGGGGAGGAGATGG - Intergenic
1142698615 17:1646684-1646706 GGCAGGGGATGGTGAGAAAAGGG + Intronic
1142810373 17:2393166-2393188 CGTAGGGGATGGAGGGACGTGGG - Intronic
1142958256 17:3535483-3535505 GGAAGGGGAAGGAGGGAAGAAGG - Intronic
1142972386 17:3621583-3621605 GGGAAGGAATGGAGAGAAGGAGG - Intronic
1143482189 17:7234217-7234239 CGGTGGGGTTGGGGAGACGAAGG - Exonic
1143622073 17:8086448-8086470 AGCTGGGGATGGAGAGAAGGAGG - Intronic
1143628569 17:8124249-8124271 GGGAGGGGAAGGAGAGAAACTGG + Intergenic
1143704489 17:8687430-8687452 GGGAGGGGGAGGAGAGGAGAGGG - Intergenic
1143709660 17:8725601-8725623 AGTAGGGGAAGGACAGAAGAGGG - Intergenic
1143904769 17:10199255-10199277 GGGACGGAATGGAGAGAAGACGG + Intergenic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1144320607 17:14115389-14115411 TGGAGAGGATGCAGAGAAAAGGG + Intronic
1144472774 17:15559577-15559599 TGGAGGGGGAGGGGAGAAGAAGG + Intronic
1144561002 17:16320276-16320298 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
1144867667 17:18347304-18347326 CAGCTGGGATGGAGAGACGAGGG - Intronic
1144877798 17:18411448-18411470 AGGAGGGGGAGGGGAGAAGAGGG - Intergenic
1144923706 17:18785124-18785146 TGGAGGGGGAGGGGAGAAGAAGG - Intronic
1145154423 17:20532941-20532963 AGGAGGGGGAGGGGAGAAGAGGG + Intergenic
1145733276 17:27209912-27209934 GGGAGGGGAGGGAGGGAAGCAGG - Intergenic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146143233 17:30388112-30388134 GGCAGAGGATGGAGAGATGATGG - Intronic
1146441295 17:32897326-32897348 GAGAGGGGAGGGAGGGAAGAAGG - Intergenic
1146521860 17:33531711-33531733 CGTAGAGGATGGAGGAAAGAAGG - Intronic
1146645027 17:34571565-34571587 AGGAGGCCATGGAGAGAAGTTGG + Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146932439 17:36786941-36786963 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1147166472 17:38596189-38596211 CAGAGGAGCTGGAGAGAGGAGGG + Intronic
1147176775 17:38660694-38660716 AGGAGCTTATGGAGAGAAGAGGG - Intergenic
1147360609 17:39927425-39927447 GGGAGGGGCGGGAGAGAAGGTGG - Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147501503 17:40968559-40968581 TGGAGAGGATGGAGAGAAATTGG - Intergenic
1147565415 17:41533293-41533315 AGGAGGGGAGGGAAAGAAGGAGG + Intergenic
1147726579 17:42569323-42569345 TGGAGGGGATGGAGCCAAGCGGG + Intronic
1147780132 17:42935024-42935046 GGGAGGGGAGGGAAAGACGATGG - Intergenic
1147918183 17:43900830-43900852 CGGTGGGGATGGGGAGGAGGCGG + Intronic
1148580186 17:48738328-48738350 TGGAGGGCATGGAGAGACCAGGG - Intergenic
1148798956 17:50211102-50211124 GGGAGAGGAGGGAGAGAAGGAGG - Intergenic
1148960780 17:51390997-51391019 CCCAGGGGATGCAGAGCAGATGG + Intergenic
1149289972 17:55208560-55208582 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1149482897 17:57017968-57017990 GGCAGAGGATGGAGAGATGATGG - Intergenic
1149612387 17:57967128-57967150 CGCAGGGGATCCAGAGCAGAGGG - Intergenic
1149647225 17:58249450-58249472 CGGAGGGGACGCAGAGAAGGGGG - Intronic
1150149661 17:62798849-62798871 GGCAGGGGCTGGAGAGCAGAGGG + Intronic
1150521988 17:65878209-65878231 AGGAAGGGAGGGAGGGAAGAAGG + Intronic
1150552232 17:66221366-66221388 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
1150582508 17:66487653-66487675 TGGTGGGGATGCAGAGAAAAGGG - Intronic
1150628610 17:66859846-66859868 GGGTGGAGAGGGAGAGAAGAGGG - Intronic
1150644362 17:66968713-66968735 AGGAGAGGAAGGAGAGAAGGAGG - Intronic
1150964168 17:69948443-69948465 GGGAGGGGAAGGGGAGGAGAAGG + Intergenic
1151213891 17:72564326-72564348 GGGCAGGTATGGAGAGAAGAAGG + Intergenic
1151345720 17:73500199-73500221 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151345753 17:73500321-73500343 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151345782 17:73500436-73500458 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151345830 17:73500650-73500672 TGGAGGAGATGGAGTGAGGAGGG - Intronic
1151345884 17:73500873-73500895 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151606806 17:75142642-75142664 AGGGGGGGATGGAGGGAAGGGGG + Intronic
1151807093 17:76412534-76412556 AGGAGGGGAGGGAGAGAGGCTGG - Intronic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1152003235 17:77660436-77660458 AGGAAGGGAGGGAGAGAAGAAGG - Intergenic
1152005531 17:77677980-77678002 GGGAGGGGAGGGAGAGGAGCCGG - Intergenic
1152219000 17:79050624-79050646 GGCAAGCGATGGAGAGAAGAAGG - Intergenic
1152296024 17:79467361-79467383 CGGGGAGGAGGGAGAGAAGGTGG + Intronic
1152362360 17:79838740-79838762 CGGAGGAGCTGGAGAGACGCGGG - Intronic
1152617418 17:81344414-81344436 CGGAGGCGAAGGAGGCAAGATGG - Intergenic
1152726989 17:81952348-81952370 GGGAGGGGAGGGAGAGGAGGAGG + Intergenic
1152726996 17:81952365-81952387 AGGAGGGGAGGGAGAGGAGGAGG + Intergenic
1152727003 17:81952382-81952404 AGGAGGGGAGGGAGAGGAGGAGG + Intergenic
1152727010 17:81952399-81952421 AGGAGGGGAGGGAGAGGAGGAGG + Intergenic
1152727031 17:81952451-81952473 GGGAGGGGAGGGAGAGGAGGAGG + Intergenic
1153493181 18:5670841-5670863 TGGAGTGGGTGGAGTGAAGAGGG + Intergenic
1153619236 18:6961609-6961631 CGGCGGGGATGTGGAGAAGCGGG - Exonic
1153770931 18:8416039-8416061 GGGAGGAGATGGAGAGAGGGTGG - Intergenic
1154138932 18:11805981-11806003 TGGGGAGGATGGAGAGAAAAGGG - Intronic
1154203595 18:12318264-12318286 GGGAAGGGGTGGAGAGAAGTTGG + Intronic
1154959733 18:21296426-21296448 TGGAGGGGATGGAGAGAGGGTGG + Intronic
1155104016 18:22642639-22642661 TGGAGGAGATGGGGAGAAGATGG + Intergenic
1155131218 18:22936597-22936619 GGGAGGGGAAGGAAAGAATAAGG - Intronic
1155283243 18:24262777-24262799 GGTAGGGGGTGGAGAGAAGGGGG - Intronic
1155507696 18:26548707-26548729 CGCAGGGGATGGAGGGGAGGGGG + Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155762150 18:29582085-29582107 AGGAAGGAAGGGAGAGAAGAAGG + Intergenic
1156754978 18:40512614-40512636 TGGAGGGGATGTGGAGAAGTGGG - Intergenic
1156851826 18:41737567-41737589 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1156987491 18:43365772-43365794 AGGAAAGGAGGGAGAGAAGAAGG + Intergenic
1157011561 18:43655191-43655213 CCGAGGGGAGGGAGAGAATTAGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157239674 18:45997632-45997654 GGGAGGGGAGGGAGGGAAGGGGG - Intronic
1157328446 18:46686013-46686035 GGATGGGGCTGGAGAGAAGAAGG + Intronic
1157392922 18:47317857-47317879 AGGAAGGGAAGGAGAGAAGGAGG - Intergenic
1157414358 18:47489727-47489749 TGGGGGGGATGGAGAAAAGGGGG + Intergenic
1157866129 18:51186390-51186412 CAGATGGGAAGGAGAGCAGAGGG + Intronic
1157890995 18:51417887-51417909 TGGGTGGGGTGGAGAGAAGAAGG - Intergenic
1158259139 18:55588246-55588268 GGGAGGGGACGGAGGGAAGGGGG + Intronic
1158272388 18:55730564-55730586 CGAAGAGGTTGGAGAGGAGAAGG + Intergenic
1158411795 18:57212051-57212073 CAGAGGGAATGAAGAAAAGAAGG + Intergenic
1158462283 18:57656820-57656842 GGGAGGGGAGAGAGAGAAGGAGG + Intronic
1158900192 18:61955184-61955206 AGGAGGGGATAGCGAGAGGATGG - Intergenic
1158931489 18:62328217-62328239 AGGAGGGGAGGGAGAGAGGGAGG + Intronic
1159564298 18:70031788-70031810 GGGAGGGCATCGAGAGCAGATGG + Intronic
1159964111 18:74579320-74579342 GGGAGGGGATGGAGAGGGGAGGG - Intronic
1159987291 18:74858149-74858171 GGGAAGGGAGGGAGAGAGGAAGG - Intronic
1160122225 18:76140798-76140820 GGGAGGGGACAGAGAGAAGTGGG + Intergenic
1160570675 18:79815698-79815720 CCGTGGGGAGGGAGAAAAGAGGG + Intergenic
1160612825 18:80101769-80101791 TTGAGGTGATGGTGAGAAGATGG + Intergenic
1160635278 19:70840-70862 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1161022382 19:2016115-2016137 GGGAGGGGACGGGGAGGAGAGGG + Intronic
1161139597 19:2639720-2639742 GGGAGGGAAGGGAGAGAAGGAGG + Intronic
1161756652 19:6138719-6138741 AGGAAGGGAGGGAGAGAGGAAGG + Intronic
1161800260 19:6413525-6413547 AGGGCGGGAGGGAGAGAAGAGGG + Exonic
1161814327 19:6490314-6490336 AGGGAGGGAGGGAGAGAAGAGGG - Intergenic
1161848273 19:6724830-6724852 AGCAGGGGAGGGAGAGAAGGAGG + Intronic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162011046 19:7815341-7815363 GAGAGGGGATGGAGAGAGAAGGG + Intergenic
1162038181 19:7953570-7953592 GGGAGGGGGAGGAGAGAAGGAGG - Intergenic
1162137967 19:8567820-8567842 AGGATGGGTTGGGGAGAAGATGG + Intronic
1162274007 19:9638800-9638822 AAGAGGGGATGCAGAGGAGAAGG + Intronic
1162524156 19:11197666-11197688 GGGTGGGGATGGAGAGACGCTGG + Intronic
1162548494 19:11345462-11345484 GGGTGGGGATGGAAATAAGAGGG - Intronic
1162793311 19:13074050-13074072 TGGGGGGAGTGGAGAGAAGATGG - Intronic
1163082340 19:14953085-14953107 GGGAGCAGATGGAGGGAAGAAGG + Intronic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1164080994 19:21861265-21861287 AGGAGGGGATGTAAAGTAGAAGG - Intergenic
1164176469 19:22779745-22779767 CGGAGGGGATGGCGAATGGAGGG - Intronic
1164250177 19:23468964-23468986 AGGAGGAGATGAAGAGAAAAAGG - Intergenic
1164292378 19:23879982-23880004 AGGAGAGGAGGAAGAGAAGAAGG + Intergenic
1164463231 19:28465873-28465895 AGAAGGAGAAGGAGAGAAGAAGG + Intergenic
1164648711 19:29876786-29876808 CAGAGGGGCTGAAGAGAGGAGGG - Intergenic
1164658345 19:29940900-29940922 GGCTGGGGATGGAGAGAGGATGG + Intronic
1164794398 19:31014573-31014595 AGGAAGGGAGGGAGAGAAGGAGG + Intergenic
1164866833 19:31611381-31611403 GGGAGGGGAGAGAGAGGAGAGGG + Intergenic
1164869821 19:31633405-31633427 GAGACGGGAGGGAGAGAAGATGG + Intergenic
1165085262 19:33341148-33341170 AGGAGGGGAGGGAGAGAGGGAGG + Intergenic
1165183055 19:33989429-33989451 GGGAAGGGATGAAGAGAAGATGG - Intergenic
1165256678 19:34580505-34580527 GGGAGAGGATGGGGAGAAGGAGG - Intergenic
1165741189 19:38206257-38206279 CTGAGGGGAAGGAGCGAAGGCGG - Exonic
1165793518 19:38506020-38506042 GGGAAGGGATGGAGAGGAGAGGG + Intronic
1165940028 19:39410299-39410321 GGTAGGGAAAGGAGAGAAGAGGG - Intergenic
1166198953 19:41223787-41223809 GGGAGGGGAGGGAGAGAAATGGG + Intronic
1166301569 19:41914396-41914418 AGGAGGAGATGGAGACGAGAGGG - Intronic
1166409418 19:42546822-42546844 GGGAAGGGATGGAGAGGGGAGGG + Intronic
1166556730 19:43705134-43705156 GGGAGGGGAGGGAAAGGAGAAGG - Intergenic
1166948082 19:46409243-46409265 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1166982359 19:46638863-46638885 CGGAGGGAGAGGACAGAAGATGG + Intergenic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167727642 19:51227352-51227374 TGGTGAGGATGTAGAGAAGAGGG - Intronic
1167791987 19:51688985-51689007 AGGAGGCGCAGGAGAGAAGAGGG + Intergenic
1168156239 19:54474269-54474291 CGCAGGGGATGGAGTGAAGCAGG + Intergenic
1168261855 19:55199705-55199727 AGGAGGGGAGGGAGAAAGGAAGG + Intronic
1168456251 19:56511018-56511040 TGGTGGGGATTGAGTGAAGAAGG + Intronic
1168725043 19:58576380-58576402 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
925132217 2:1502066-1502088 CCCAGGGGATGGAGAGAAAATGG + Intronic
925222161 2:2150851-2150873 GGGAAGGGAAGGAGGGAAGAAGG + Intronic
925299473 2:2800277-2800299 AGGAAGGGAAGGAGAGAAGGAGG + Intergenic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
925462554 2:4075854-4075876 GGGAAGGGAAGGAGAGGAGAAGG - Intergenic
925625897 2:5841943-5841965 AGGGGAGGATGGAGAGAGGAGGG + Intergenic
925664655 2:6239881-6239903 TGAAAAGGATGGAGAGAAGATGG - Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926191577 2:10732206-10732228 AGGGAGGGATGGAGGGAAGAAGG - Intronic
926306378 2:11640012-11640034 CGGAGAGGAAGGAGAGAGGCTGG - Intronic
926707848 2:15849314-15849336 AGGGGGAGGTGGAGAGAAGATGG + Intergenic
926824061 2:16884724-16884746 AGGATGGGAGGGAGAGAGGAAGG - Intergenic
926836566 2:17030375-17030397 GGAAGAGCATGGAGAGAAGAGGG - Intergenic
926853464 2:17226651-17226673 AGGAGGGGGTGGTGAGGAGAGGG + Intergenic
926958819 2:18332218-18332240 AGCAGAGGATGGAGAGATGATGG - Intronic
926964541 2:18395839-18395861 GGGAGGGGATGGATAGGATACGG + Intergenic
926996860 2:18744958-18744980 AGGAGGGGCTGGAAAGAGGAAGG + Intergenic
927220654 2:20705483-20705505 AAGAGGGGATGGAGAAAACAGGG - Intronic
927282967 2:21326857-21326879 CTGAGGGGATGGTGTGTAGATGG - Intergenic
927476345 2:23417108-23417130 CAGAGGCAATGAAGAGAAGAAGG - Intronic
927512105 2:23650195-23650217 CTCAGGGGCTGGAGAAAAGAGGG + Intronic
927578883 2:24223767-24223789 GGGAGGGGAGTGAGGGAAGAAGG + Intronic
928144198 2:28757041-28757063 GGGAGGGAATGGAGAGAAATGGG - Intronic
928354099 2:30593040-30593062 CGGGAGGGATGTAGAGAAGTTGG - Intronic
928648437 2:33379616-33379638 CAGAGGGGAAGGAAAGAGGAGGG + Intronic
928903334 2:36344627-36344649 CGGAGGGGAGGGAGGGGAGAAGG + Intergenic
928926537 2:36585505-36585527 GGGTGGGGAGGGAGAGCAGAAGG + Intronic
929059951 2:37913941-37913963 AGGAGGAGAAGGAGAAAAGACGG + Intergenic
929734898 2:44537531-44537553 TGGTGAGGATGGAGAGAAAAGGG + Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930249690 2:49021541-49021563 TGGAGGGGAGGGAAAAAAGAAGG + Intronic
930253266 2:49060195-49060217 CGGTGAGGATGCAGAGAAAAAGG + Intronic
930330867 2:49981389-49981411 TGAAGGGGAGGGAGGGAAGAGGG + Intronic
930540099 2:52694882-52694904 GGTTGGGGATGGAGAGAACAGGG + Intergenic
931088174 2:58857148-58857170 CAGGAGGGATGGAGAGATGAAGG + Intergenic
931356220 2:61538988-61539010 TGGAAGGGGTGGAGAAAAGAGGG + Intergenic
931773397 2:65518655-65518677 AGGAAAGGATGGAGGGAAGAAGG - Intergenic
931804179 2:65788636-65788658 GGGAGGTGATGGACAGAAGGTGG - Intergenic
932054724 2:68432732-68432754 AAGAGAGGATGGAGAGATGATGG - Intergenic
932207756 2:69898437-69898459 GAGAGGGGATGGAGAGAGGGAGG + Intronic
932465590 2:71922153-71922175 TGGGGGGACTGGAGAGAAGAGGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932761229 2:74440370-74440392 GGGAGGAGAGGGAGAGAGGAAGG + Intronic
933214324 2:79610704-79610726 GGGATGGGATGGAGAGAGGAGGG + Intronic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
933350026 2:81142083-81142105 GAGAGGGGATGAAGAGAAGTTGG - Intergenic
934784399 2:96994460-96994482 CAAAGAGGATGGAGAGCAGAAGG - Intronic
934880447 2:97972449-97972471 GGGAGGGGAGGGAGGGAAGGCGG + Intronic
934947156 2:98550240-98550262 GGGAGGGGATGGAGCGGGGAGGG + Intronic
935540312 2:104340582-104340604 CGGAGGGGAAAGAGTGAGGAAGG - Intergenic
935646964 2:105345524-105345546 AGGAAGGGAGGGAGGGAAGAAGG - Exonic
935985453 2:108668349-108668371 TGGAGGGGATGGGGAGAAGATGG - Intronic
935999357 2:108811123-108811145 GGGAGGGGAAGAAGGGAAGAAGG - Intronic
936080675 2:109430498-109430520 AGGAGGAGATGGGGAGAGGATGG - Intronic
936137883 2:109911996-109912018 TGGAGGGGATGGGGAGAAGATGG - Intergenic
936206814 2:110459489-110459511 TGGAGGGGATGGGGAGAAGATGG + Intronic
936242852 2:110802742-110802764 AGGAGGGGATGGGGAGAGGTTGG + Intronic
936566202 2:113584203-113584225 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
936687910 2:114849981-114850003 GGGAGGGGATGGGGAGGAGAGGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936811896 2:116412951-116412973 AGGAGGGGAGGGAGCCAAGATGG + Intergenic
936903019 2:117505365-117505387 AGGAGGAGATGGGGAGGAGAAGG - Intergenic
936911902 2:117602240-117602262 TGGGGGAGATGGAGAGAAGCAGG - Intergenic
937063570 2:118999291-118999313 CGGAGAGGATGTGGAGAAGCAGG - Intergenic
937153401 2:119701437-119701459 TTGAGGGGATTGAGAGCAGAGGG + Intergenic
937222642 2:120350618-120350640 GGGGAGGGAGGGAGAGAAGAGGG + Exonic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937267650 2:120626633-120626655 TGGAGAGGCTGGAGAGAGGAAGG - Intergenic
937304994 2:120865696-120865718 TGGCAGGGATGGGGAGAAGATGG - Intronic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
938061565 2:128259294-128259316 GGGAGGGGAGGGGGAGGAGAAGG - Intronic
938076228 2:128340038-128340060 GGGAGGGAAGGGAGAGGAGAGGG + Intergenic
939256140 2:139747011-139747033 CGGAAGAGAAAGAGAGAAGAGGG + Intergenic
939376126 2:141370281-141370303 TGGAAGGGATGTAGAGAAAAGGG - Intronic
939606601 2:144262626-144262648 GGGAGGGGAGGGAGAGGGGAGGG + Intronic
939623232 2:144446333-144446355 AGGAAGGGAGGGAGAAAAGAAGG - Intronic
939733849 2:145819312-145819334 AGGAGGGGATGGAGGGAGGAAGG - Intergenic
939733892 2:145819439-145819461 GGGAGGGGATGGAGGGATGGAGG - Intergenic
939799998 2:146696910-146696932 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
941114323 2:161454277-161454299 TGGGAGGGATGGAGGGAAGAAGG - Intronic
941163760 2:162063561-162063583 CCGAGGGGAGGTGGAGAAGAAGG + Intronic
941188026 2:162341740-162341762 GGTTGGGGATGGAGAGAAAAGGG + Intronic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
941464968 2:165814655-165814677 AGGAAGGGAAGGAGAGAAGGAGG + Intergenic
941684834 2:168437846-168437868 TGCATGGTATGGAGAGAAGAAGG + Intergenic
942194820 2:173507039-173507061 TGGCAGGGAGGGAGAGAAGATGG + Intergenic
942342312 2:174961196-174961218 GGGAAGGGAGGGAGGGAAGAAGG + Intronic
942462449 2:176177913-176177935 CGAGGGGGATTGAGGGAAGATGG - Intergenic
942529902 2:176898391-176898413 TGGTGAGGATGGAGAGAAAAGGG - Intergenic
942729848 2:179052059-179052081 GGGATGGTATGGAGAGATGATGG + Intergenic
942763800 2:179430146-179430168 TGGAGGGAATGGGGAGACGATGG + Intergenic
942873439 2:180764173-180764195 GGGAGGGGATGGAGAAAAAAGGG + Intergenic
943060964 2:183040825-183040847 AGGAAGGGAGGGAGAGAGGAAGG + Intergenic
943687552 2:190834768-190834790 AGGAAGGGAGGGAGAGAGGAAGG - Intergenic
944154975 2:196598441-196598463 GGGAGGGGAAGGGGAGGAGAAGG + Intergenic
944155007 2:196598513-196598535 GGGAGGGGATGGAGAGAGGAGGG + Intergenic
944155018 2:196598535-196598557 GGGAGGGGATGGGGAGAGGGAGG + Intergenic
944797241 2:203199812-203199834 GGGAGGGAATGGAGGGAGGAAGG - Intronic
945094007 2:206202338-206202360 TGGAGGCTATAGAGAGAAGACGG + Intronic
945375647 2:209076976-209076998 AGAAGGAGATGGAGTGAAGAGGG - Intergenic
946109737 2:217404111-217404133 GGGAGGGGAGGGAGGGAAGAAGG - Intronic
946160595 2:217833474-217833496 CCAAGAGGAGGGAGAGAAGAAGG + Intronic
946176810 2:217927333-217927355 TGGAAGGGATGAAGGGAAGAAGG + Intronic
946180934 2:217948528-217948550 GGGAGGGCATGGTCAGAAGAGGG - Intronic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946419075 2:219554746-219554768 CGGGGGAGATGGAGAGAGGGAGG + Intronic
946886917 2:224230491-224230513 GGGATGGGATGGAGAGATAATGG - Intergenic
947422526 2:229953707-229953729 AAGAGGGGAAGGAGAGAGGAGGG + Intronic
948145218 2:235703540-235703562 AGGAGGGGGAGGGGAGAAGAGGG - Intronic
948172594 2:235917151-235917173 AGGGGGGGATGTAGAGGAGAAGG - Intronic
948349940 2:237331387-237331409 AGGAGGGGAGGGAGAGAGGTTGG + Intronic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
948700246 2:239755109-239755131 GGGATGGGATGGATAGATGATGG + Intergenic
948724248 2:239922041-239922063 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
1168744072 20:221336-221358 GGGAGGGAATGGAGGGAAGGAGG + Intergenic
1168814618 20:728230-728252 CGGTGGGGGTGGGGAGCAGACGG + Intergenic
1168975603 20:1963216-1963238 AGGAAGGGACGGAGAAAAGAAGG + Intergenic
1169068208 20:2706353-2706375 CGGAGGGCATAGGGAGATGAGGG - Intronic
1169423449 20:5477766-5477788 CAGAGGGGATCAAGAGAAGGGGG + Intergenic
1169424727 20:5486916-5486938 CAGAGGGGATCAAGAGAAGGGGG + Intergenic
1169427552 20:5508510-5508532 CAGAGGGGATCAAGAGAAGGGGG - Intergenic
1169541210 20:6601494-6601516 CGGAGGAGATGGAAAGACAAAGG - Intergenic
1169991076 20:11503098-11503120 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1170248337 20:14249432-14249454 TGGCAGGGATGGAGAAAAGAGGG + Intronic
1170613762 20:17933555-17933577 GGGAGGGGATGGAGAGCAAAGGG + Intergenic
1170631742 20:18072317-18072339 AGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1170631766 20:18072373-18072395 AGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170813916 20:19696952-19696974 AGGAGGAGAGGGAGGGAAGAAGG + Intronic
1170950314 20:20930758-20930780 AGGAGGGGATGGTGAGGATAGGG - Intergenic
1171941145 20:31331014-31331036 AGGGGGAGAAGGAGAGAAGAAGG + Intergenic
1171941153 20:31331072-31331094 AGGAGAAGAAGGAGAGAAGAAGG + Intergenic
1172113929 20:32562896-32562918 TGGAGGGGAGGGAGAGTAGAGGG + Intronic
1172113970 20:32563015-32563037 TGGAGGGGAAGGAGGGTAGAGGG + Intronic
1172204555 20:33153764-33153786 AGGAAGGGAGGGAGAGAAGGAGG + Intergenic
1172423934 20:34842276-34842298 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1172596456 20:36154300-36154322 GGGAGGGGGAGGAGAGAAGAGGG - Intronic
1172607063 20:36221130-36221152 AGGAGTGGATAGAAAGAAGAGGG - Intronic
1172632279 20:36386440-36386462 AGGAAAGGATGGAGGGAAGAAGG + Intronic
1172690431 20:36785943-36785965 AGGAGGTGGTGGAGAGAAGGAGG + Exonic
1172754574 20:37274090-37274112 GGGAGGGGAGGGAAAGGAGAAGG + Intergenic
1172773499 20:37394729-37394751 CAGAGGGGCTGGAGAGAAAGGGG - Intronic
1172895946 20:38300077-38300099 CTGAGGGGAGGGAGAGTACAGGG + Intronic
1173002056 20:39111663-39111685 GGGAGGGGAGGGAGAGGAGGGGG + Intergenic
1173230945 20:41197073-41197095 CAGGGCTGATGGAGAGAAGAAGG + Intronic
1173313087 20:41917711-41917733 GGGAAGGGAGGGGGAGAAGAGGG + Intergenic
1173662731 20:44745550-44745572 GGGAGGGGAGGGAGGGAAAAAGG + Intergenic
1173955040 20:47025095-47025117 TGGAGGTGATGAAGAGATGATGG - Intronic
1174140835 20:48412574-48412596 AGGAAGGGAGGGAGGGAAGATGG - Intergenic
1174418168 20:50381148-50381170 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1174655359 20:52167490-52167512 AGGAAGGGAGGGAGAGAAGAAGG - Intronic
1174723576 20:52838872-52838894 GGGAGGGGAAGGGGAGGAGAGGG - Intergenic
1175062294 20:56254637-56254659 ATGAGGGGAAGGAGAGGAGAAGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175250044 20:57603788-57603810 TGGAGGGGATGGAGTCAGGAGGG - Intergenic
1175273912 20:57754499-57754521 AGGAAGGGAGGGAGAGAAGAAGG - Intergenic
1175487417 20:59355801-59355823 GGGGGGAGAGGGAGAGAAGAGGG - Intergenic
1175569925 20:60010725-60010747 AGGAGGAGATGGTGAGAAGAGGG + Intronic
1175683451 20:61008671-61008693 CTGGGAGGGTGGAGAGAAGATGG - Intergenic
1175857306 20:62129015-62129037 GGGAGGAGATGGAGAGAGGTGGG + Intronic
1175903045 20:62367424-62367446 GGGGGGGGAAGGAGAGAGGAGGG + Intergenic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176125466 20:63472836-63472858 GGGAGGGGAGGGAGAGGGGACGG + Intergenic
1176184599 20:63771385-63771407 AGGAGGGGAGGGAGAGAGGGGGG + Intronic
1176332516 21:5561146-5561168 GGGAGGGGAAGGAGAGCAGCAGG - Intergenic
1176389354 21:6155705-6155727 GGAAGGAGAAGGAGAGAAGAGGG + Intergenic
1176395241 21:6259805-6259827 GGGAGGGGAAGGAGAGCAGCAGG + Intergenic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176441916 21:6729299-6729321 GGGAGGGGAAGGAGAGCAGCAGG - Intergenic
1176466178 21:7056368-7056390 GGGAGGGGAAGGAGAGCAGCAGG - Intronic
1176489739 21:7438146-7438168 GGGAGGGGAAGGAGAGCAGCAGG - Intergenic
1177073542 21:16542968-16542990 AGGGAGGGAGGGAGAGAAGAAGG + Intergenic
1177264583 21:18765788-18765810 TGGAAGGGATGAAGGGAAGAGGG - Intergenic
1178403440 21:32306285-32306307 AGGATGGGAGGGAGAGGAGAGGG - Intronic
1178529228 21:33361324-33361346 CGGAGCGGATGGAAAGAAGTAGG + Intergenic
1178624349 21:34202790-34202812 AGGAGGGGATGGAGGCGAGATGG + Intergenic
1178803055 21:35815068-35815090 AGGAGGGAAGGAAGAGAAGAGGG - Intronic
1179084919 21:38207793-38207815 GAGAGGGGATGGGGAGAGGAGGG - Intronic
1179150588 21:38805693-38805715 GGGAGCGGAGGGAGAGGAGAGGG - Intronic
1179229666 21:39489997-39490019 ATGAGGGTATGGAGAAAAGAAGG + Intronic
1179236735 21:39554141-39554163 AGGAGGACATGGAGAGAGGAAGG - Intergenic
1179273017 21:39866009-39866031 AGGAGGGGAGTGAGAGAAGGAGG + Intergenic
1179351956 21:40620406-40620428 AGGGAGGGAGGGAGAGAAGAGGG + Intronic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1179714350 21:43280006-43280028 TGGAGGGGAGGTAGAGAGGAGGG + Intergenic
1179734115 21:43382533-43382555 GGAAGGAGAAGGAGAGAAGAGGG - Intergenic
1180004602 21:45014540-45014562 CAGAGGGGAGAGAGACAAGAGGG + Intergenic
1180084755 21:45503203-45503225 CGGAGAGGATGTAGAGAAATAGG - Intronic
1180115717 21:45703677-45703699 CGGGGGGCATGAACAGAAGAAGG + Intronic
1180735025 22:18010028-18010050 GGGAGGGGAGGGAGGGAAGCAGG + Intronic
1180892238 22:19297516-19297538 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1180951738 22:19723557-19723579 CGGAGCCCATGGCGAGAAGACGG - Exonic
1181082102 22:20422896-20422918 CCGAGGGGGTGGGGAGAAGCGGG + Intergenic
1181438642 22:22924525-22924547 AGGAAGAGAGGGAGAGAAGAAGG - Intergenic
1181759227 22:25046403-25046425 AGGAAGGGATGGAGAGAGGAAGG - Intronic
1181759231 22:25046419-25046441 AGGAAGGGATGGAGAGAGGAAGG - Intronic
1181787470 22:25237543-25237565 AGGAGAGGAAGGAGAGAAGGTGG - Intergenic
1182113580 22:27742080-27742102 AGGAGGGAAAGGAGAAAAGAGGG - Intergenic
1182193639 22:28491107-28491129 GAGATGGGATGGAGAGAAGCAGG - Intronic
1182440106 22:30358050-30358072 CGCAGGAGAGGGAGAGAAGCCGG - Intronic
1182578840 22:31291634-31291656 AGGAGGAGATGGAGAGGAGGAGG + Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1182950023 22:34365075-34365097 AAGATGGGATGGAGAGAAGGAGG + Intergenic
1183085406 22:35483783-35483805 GGGAGGGGAAGAAGAGAGGAAGG + Intergenic
1183108341 22:35630314-35630336 CGGAGGGGAAGGAGAAGAGGAGG + Intronic
1183130711 22:35832492-35832514 GGCAGGGGATGGAGAGAGGTTGG + Intronic
1183366926 22:37411784-37411806 TGGAGGGGATGGAGTGAAATAGG - Intronic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183406426 22:37632714-37632736 CAGAGGGGCTGGGGAGAGGAAGG + Exonic
1183409657 22:37647366-37647388 GGGAGGGGATGGGGAGGAGGAGG + Intronic
1183438631 22:37810004-37810026 CTGAGGTGAAGGAGAGGAGATGG - Exonic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1183576939 22:38697192-38697214 AAGAGGTGAGGGAGAGAAGATGG - Intronic
1183625699 22:39000011-39000033 TGGAGGAAATGGAGAGAGGATGG - Intergenic
1183698797 22:39438162-39438184 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184229952 22:43153017-43153039 GGGAGGGGAGGGAGGGAGGAAGG - Intronic
1184355359 22:43975901-43975923 AGAAGGGGAAGAAGAGAAGAAGG - Intronic
1184730377 22:46368312-46368334 CAGAGGGGATGGAGTGAATCCGG + Intronic
1185110205 22:48896397-48896419 GGGATGGGGTGGAGAGCAGAGGG + Intergenic
1185147994 22:49149728-49149750 GGGAGGGGACAGAGAGAAGCAGG + Intergenic
1185415285 22:50706057-50706079 CGGTGGGGCTGCAAAGAAGAGGG - Intergenic
949114673 3:305758-305780 TGGCAGGGATGGGGAGAAGAGGG + Intronic
949446244 3:4136980-4137002 CGGAGGGGATGTGGAGAAATAGG + Intronic
949765740 3:7523814-7523836 ATGCGGGGATGGGGAGAAGAAGG + Intronic
949830926 3:8213248-8213270 AGGAAAGGATGGAGGGAAGAAGG - Intergenic
950001878 3:9663027-9663049 TGGAGGGGATTGAATGAAGACGG + Intronic
950040188 3:9915177-9915199 CCGAGAGGGTGGGGAGAAGAGGG + Intronic
950163165 3:10774913-10774935 GAGAGGGGAGGGAGAGAAAATGG - Intergenic
950254351 3:11492472-11492494 TGGAGGGGCTGGAGCCAAGATGG - Intronic
950462878 3:13135647-13135669 CGGAGTGGGTGGAGAGAAGGGGG + Intergenic
950565352 3:13766695-13766717 AGGAGTGGAGGGAGTGAAGATGG - Intergenic
950795958 3:15510833-15510855 AGGAAGGGAGGGAGAGAGGAAGG + Intronic
951156334 3:19358269-19358291 GGGAGGAGAAAGAGAGAAGAAGG - Intronic
951198695 3:19853988-19854010 TGGAGGGGATGTGGAGAAAAAGG + Intergenic
951534106 3:23726014-23726036 GGGAGGGGAGGGAGAGAGGGAGG + Intergenic
951710891 3:25584148-25584170 AGGATGGGAGGGAGGGAAGAGGG - Intronic
951757503 3:26107343-26107365 TGGAGAGGATGCAGAGAAAAAGG - Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952307268 3:32157335-32157357 CAGAGGGGATGGAGTGAACCTGG - Intronic
952364392 3:32662066-32662088 CTGAGGGGAGGGAGTGGAGAGGG + Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952740742 3:36731798-36731820 GTGAGGGGAGGGAGAAAAGAAGG - Intronic
952867123 3:37861805-37861827 AGGAAGGGAGGGAAAGAAGAAGG - Intergenic
953121854 3:40052164-40052186 AGGAAGGGATGAAGAGAAGTTGG - Intronic
953156241 3:40377100-40377122 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
953240130 3:41141265-41141287 GGGAGGCGATGGAGAGGAGCTGG - Intergenic
953439268 3:42904167-42904189 GGGAAGGGAGGGAGAGAGGAAGG - Intronic
953563497 3:44012672-44012694 CGGCGGAGATGGGGAGACGATGG - Intergenic
953920680 3:46949278-46949300 CGGAGGGGGAAGAGAGCAGAGGG + Intronic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG + Intronic
954437477 3:50503693-50503715 AGGGAGGGAGGGAGAGAAGAGGG - Intronic
954534276 3:51346771-51346793 TGGAGAGGATGGGGAGAAGTAGG - Intronic
954773017 3:52990672-52990694 GGAAAGGGAGGGAGAGAAGAAGG + Intronic
954983382 3:54767026-54767048 GGGAGGTGGTGCAGAGAAGATGG - Intronic
955062822 3:55507897-55507919 AGGAGGGGAAAGGGAGAAGAAGG + Intergenic
955194460 3:56792243-56792265 CATATGGGATGTAGAGAAGAGGG - Intronic
955241376 3:57181531-57181553 GGGATGGGATGGAAAGAAGGAGG - Intergenic
955587362 3:60495105-60495127 TGGCGGGGATGTAGAGAAAAGGG - Intronic
955656129 3:61246919-61246941 TGGAGGAGGTGGAGAGAATAAGG - Intronic
955874602 3:63476238-63476260 AGGAAAGGAGGGAGAGAAGAAGG + Intronic
955874645 3:63476371-63476393 AGGAAAGGAGGGAGAGAAGAAGG + Intronic
955874653 3:63476399-63476421 AGGGAGGGAGGGAGAGAAGAAGG + Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956486031 3:69722744-69722766 AGGAAGGGAGGGAGAGAGGAAGG + Intergenic
956732407 3:72208602-72208624 AGGGAGGGAGGGAGAGAAGAAGG + Intergenic
956765687 3:72482545-72482567 AGGAAGGGATTGAGAGGAGAGGG - Intergenic
957740726 3:84264996-84265018 GGGAGGGGATGGAGGGAGCAAGG - Intergenic
957779211 3:84796974-84796996 TGGAGAGGATGTAGAGAAAATGG + Intergenic
957856032 3:85879995-85880017 CAGGGGCGATGGAGAGTAGAGGG - Intronic
957867030 3:86039078-86039100 CAGAGGGGGTGGAGCCAAGATGG + Intronic
958005219 3:87802028-87802050 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
958800011 3:98744348-98744370 CTCAGGGGATGCAGAGAAGAGGG - Intronic
958833251 3:99114963-99114985 CAGAGGGGCTGGAGCTAAGATGG + Intergenic
959304851 3:104649291-104649313 TGGTGAGGATGGAGAGAAAAGGG - Intergenic
959397197 3:105855263-105855285 GGGAAGAAATGGAGAGAAGAAGG + Intronic
959753129 3:109862302-109862324 GGGAGGTGAGGGAGAGAAGAGGG + Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
960153729 3:114276888-114276910 CGGAGGGGGAGGAGCCAAGATGG + Intergenic
960223709 3:115146829-115146851 CGCAGGGAGTAGAGAGAAGAAGG + Intronic
960431607 3:117575968-117575990 TGGAGGGGATGAAGAGAAGTTGG - Intergenic
961175893 3:124834663-124834685 GGGAGGGGAGGGAGGAAAGAAGG + Intronic
961208493 3:125107043-125107065 AAGAGGGGATGGACAGAAGGTGG - Intronic
961340090 3:126212152-126212174 AGGAAGGGAGGGAGTGAAGAAGG + Intergenic
961372453 3:126439963-126439985 GGGAGGAGCTGGAGAGCAGAAGG - Intronic
961632328 3:128310280-128310302 CAGAGGGAAAGGAGAGAAAAAGG - Intronic
962202893 3:133415152-133415174 GGGAGAGGATGGGGAGAGGACGG - Intronic
962240008 3:133744291-133744313 CGCAGGGCATGGAAAGAAGATGG - Intergenic
962308568 3:134310193-134310215 AGGAGGGGAGGAAGAGAAAAGGG + Intergenic
962507043 3:136057805-136057827 TGGAGAGGATGTAGAGAAAAGGG + Intronic
962611163 3:137077465-137077487 TGGAGGGAATGGAGAGAAATGGG - Intergenic
962841683 3:139238445-139238467 CACAGGGGGAGGAGAGAAGACGG - Intronic
962935234 3:140074452-140074474 CCGAGCAGATGGAGAGATGAGGG + Intronic
962967790 3:140370478-140370500 AGGGAGGGAGGGAGAGAAGAAGG + Intronic
963108402 3:141665579-141665601 AGGAGGGGAGGGAGGGAGGAAGG + Intergenic
963242846 3:143026928-143026950 GGGAGGGGATGGAAAGGTGAGGG - Intronic
963354324 3:144191319-144191341 TGGAGAGGATGAAGAGAAAAGGG - Intergenic
963913015 3:150830986-150831008 CGGATGGGACGGAGGGAGGAAGG - Intergenic
964036540 3:152206085-152206107 GGAAGAGGAGGGAGAGAAGATGG - Intergenic
964120303 3:153176229-153176251 TGGAGAGGATGTAGAGAAAAAGG - Intergenic
964205881 3:154174506-154174528 AGCAGGGGTTGGAGGGAAGAAGG + Intronic
964368397 3:155973179-155973201 GAGAGGGGATAGAGAGGAGAGGG - Intergenic
964764148 3:160162319-160162341 GGGAGAAGTTGGAGAGAAGATGG + Intergenic
964792841 3:160469329-160469351 CAGAAGGGAAGGAGAGAAAAGGG - Intronic
964815065 3:160708307-160708329 TGAAGTGGCTGGAGAGAAGAGGG - Intergenic
965667590 3:171111518-171111540 TGGTGAGGATGCAGAGAAGAGGG + Intronic
966270335 3:178097070-178097092 AGGAAGGGAGGGAGAGAGGAAGG + Intergenic
966348320 3:179003132-179003154 TGGAGAGGATAGAGAGAAGTGGG - Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
966981027 3:185135504-185135526 GGGAGGGGATGAATAGAAGTTGG + Intronic
967003950 3:185365839-185365861 GGGAGGGGATGGGGAGAAAGAGG - Intronic
967055305 3:185825028-185825050 CGGAGGAGGAGGAGAGACGAGGG - Exonic
967824214 3:193865858-193865880 AGGAGGGGCTTGAGGGAAGAGGG - Intergenic
967870283 3:194223982-194224004 AGGAGGGGATGGAGAGGATGAGG - Intergenic
967954665 3:194869076-194869098 CGCTGGAGATGGGGAGAAGAAGG + Intergenic
968315506 3:197720941-197720963 CGGTGAGGATGGGGAGAAAAGGG - Intronic
968339260 3:197941323-197941345 CAGAGGGGAGAGAGAGAGGAAGG - Intronic
968647806 4:1749010-1749032 CGGTGGGGAGGGAGAGCAGTGGG - Intergenic
968652972 4:1767354-1767376 AGGAGGGGAGGGAGGGAGGAGGG - Intergenic
968736496 4:2299639-2299661 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
968943640 4:3652400-3652422 CGGAGGGGAAGGAGAGCAGAAGG - Intergenic
968947857 4:3675004-3675026 AGGAGGGGAGGGAGAGAGGGAGG - Intergenic
969179774 4:5430260-5430282 GGTGGGGGATGGGGAGAAGAGGG - Intronic
969507057 4:7594606-7594628 AGGAAGGGAGGGAGAGAAGGAGG - Intronic
969581106 4:8065989-8066011 GGGAGGGGAGGGAGAAAGGAGGG + Intronic
969722053 4:8897597-8897619 AGGAGGGGAGGGCGAGAAGGTGG - Intergenic
969990125 4:11253572-11253594 AGAATGGGAGGGAGAGAAGAAGG + Intergenic
970240824 4:14006896-14006918 ATGAGGGGAAGGAGTGAAGAGGG + Intergenic
970444520 4:16112703-16112725 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444529 4:16112724-16112746 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444538 4:16112745-16112767 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970573485 4:17405248-17405270 AGGAAGGGAGGGAGAGAAGGAGG + Intergenic
970688647 4:18596920-18596942 AGGAGAGGATGGAGGAAAGAAGG + Intergenic
970923359 4:21421143-21421165 TGGTGAGGATGTAGAGAAGAGGG + Intronic
971133530 4:23840099-23840121 CGGAGGGTTTGGTCAGAAGAGGG - Intronic
971438731 4:26656002-26656024 TGGAGGGGGTGGAGCCAAGATGG - Intronic
972055523 4:34797185-34797207 AGGGAGGGATGGAGGGAAGAAGG - Intergenic
972632320 4:40853155-40853177 CAGAGGGCATGAAGAGAAGCAGG - Intronic
972642439 4:40937965-40937987 CGTAGGGGTGGGAGAGATGAAGG + Intronic
973043458 4:45504132-45504154 TGGAGAGGATGCAGAGAAAAAGG - Intergenic
973833772 4:54789098-54789120 AGGAGGGGAAGGAGAGAGGAGGG - Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974308584 4:60174520-60174542 CTGAGAGGATGGAGAGATGATGG - Intergenic
974522186 4:62996058-62996080 AGGAAGGAAGGGAGAGAAGAAGG + Intergenic
975044439 4:69783836-69783858 AGGAGAGGATGGAGAGAGGATGG + Intronic
975100728 4:70509992-70510014 AGGAAGGGAAGAAGAGAAGAGGG + Intergenic
975226239 4:71876234-71876256 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
975895365 4:79083793-79083815 CAGATGGGATGGAGGGAGGACGG - Intergenic
976014181 4:80530619-80530641 TAGAGGGGAAGGAGACAAGAAGG + Intronic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
976183052 4:82417405-82417427 AGGAGGGGATGGGAAGAGGATGG - Intergenic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976221815 4:82762197-82762219 GGGAGGGGAGGGGGAGAGGAGGG + Intronic
976700819 4:87966804-87966826 GGCAGAGGATGGAGAGATGAAGG + Intergenic
976748967 4:88434527-88434549 GGTTGGGGATGGAGAGGAGATGG + Intronic
977014313 4:91673639-91673661 AGGAGGGGAGGGAGGGAGGAGGG - Intergenic
977206911 4:94173536-94173558 GGGAGGGGAAGGATAAAAGAAGG + Intergenic
977531606 4:98207133-98207155 AGGAGGGTTTTGAGAGAAGATGG + Intergenic
977555910 4:98487151-98487173 AGGGGGGGATGGAGGGAAGGAGG + Intronic
977588412 4:98800764-98800786 GGTGGGGGATGGAGAGAATATGG - Intergenic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
977815997 4:101415089-101415111 AGGAAGGGAGGGAGGGAAGAAGG + Intronic
978119326 4:105059592-105059614 GGGTGGGAATGGGGAGAAGAGGG + Intergenic
978142478 4:105333340-105333362 AGGAAGGGATGAAGAGAAGTTGG + Intergenic
978277362 4:106967996-106968018 GAGAGGAGATGGAGAGATGAAGG + Intronic
978541250 4:109818522-109818544 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
978619292 4:110622776-110622798 GGGGAGGGAGGGAGAGAAGAAGG - Exonic
978629711 4:110730313-110730335 GGGAGGGGAGGGAGAGCAGCAGG - Intergenic
978925714 4:114240580-114240602 TGGTCGGGATGCAGAGAAGAGGG - Intergenic
979054210 4:115976179-115976201 CGGGGGGAATGGAGAGATAATGG + Intergenic
979429109 4:120605438-120605460 GGGAAGGGAAGGAGAGAAGAAGG + Intergenic
979521635 4:121674224-121674246 GGGAGGGGAGGGAGAGGGGAGGG + Intronic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980184035 4:129439240-129439262 GGGAGGTTAAGGAGAGAAGAAGG - Intergenic
981180977 4:141743730-141743752 TGGAGAGGATGCAGAGAAAAAGG - Intergenic
981299034 4:143166453-143166475 AGTAGGGGGTGGAGACAAGATGG + Intergenic
981307482 4:143262261-143262283 GGTAGGGGCTGGAGAGAAGATGG + Intergenic
981555675 4:145990975-145990997 CAGAGGGGATGCTGAAAAGAGGG + Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981801912 4:148667649-148667671 CCGAGGGGATGGTGGGTAGAAGG - Intergenic
981881341 4:149616746-149616768 GGGAGGGGAGGGAGAGCATAAGG + Intergenic
981964632 4:150584453-150584475 GGGATGGGGTGGAGAGAAAAAGG - Exonic
982358877 4:154497317-154497339 TGGAGGGAATGGGGAGAAGTTGG - Intergenic
982440754 4:155433049-155433071 GGGAAGGGATGAAGAGAAGTGGG - Intergenic
982693954 4:158579060-158579082 CAGAGATGCTGGAGAGAAGAGGG + Intronic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983094086 4:163541541-163541563 CGCAGGGGAAAGAGAGATGAGGG + Intronic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
984622239 4:181966952-181966974 CGAAGGGGAGGGAGAGAAGAAGG - Intergenic
984762849 4:183377365-183377387 AGGGAGGGAGGGAGAGAAGAAGG - Intergenic
984783582 4:183548087-183548109 GGGAGGAGATGGAGAGATGTTGG - Intergenic
984963556 4:185121329-185121351 AGGAGAGGATGAAGGGAAGATGG - Intergenic
985081286 4:186266868-186266890 CGGCGGGGAAGGAGGGAGGAGGG + Intronic
985195863 4:187428682-187428704 TGGAGTGGATGCAGAGAAAAGGG + Intergenic
985211907 4:187604208-187604230 AGGAAGGGAGGAAGAGAAGAGGG - Intergenic
985516628 5:348949-348971 CGGCGGGGATGCAGAGAAACTGG - Intronic
985625962 5:987830-987852 GGGAGGGGAAGGAGGGAAGGAGG + Intergenic
985831522 5:2237065-2237087 CGGAGAGGCTGCAGAGAAAAGGG + Intergenic
985937198 5:3106432-3106454 GGGAGGGGAGGGAGAGCAGAGGG - Intergenic
986424201 5:7614284-7614306 CAGAGGGGATAGAGAGATGGAGG - Intronic
986490729 5:8286921-8286943 AGGAAGGGAGGGAGAGGAGAGGG - Intergenic
986530102 5:8726995-8727017 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
986639349 5:9857155-9857177 AGGAGGAGATGAAGAGAAGTTGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987373909 5:17217452-17217474 TGGAGGGGGTGGAGGGGAGACGG + Intronic
987612236 5:20220978-20221000 TGGAGAGGATGCAGAGAAAAGGG + Intronic
987650667 5:20736442-20736464 AAGAGGTGATGGAGAGAGGAAGG - Intergenic
987723834 5:21671733-21671755 AGGAAGGGAGGGAGAGAGGAAGG - Intergenic
987910142 5:24132411-24132433 AGGAGGGGAGGGGGAGAAGAAGG + Intronic
987927155 5:24356916-24356938 TGGAGGGGATGTAGAGAAAAGGG - Intergenic
988156097 5:27450820-27450842 AGGAGGAAATGGAGAGAAGTAGG + Intergenic
988403668 5:30796214-30796236 AGGAGGGAATGGGGAGATGATGG + Intergenic
988420986 5:31005883-31005905 CGGAGAGGATGTGGAGAAAAAGG - Intergenic
988641725 5:33048246-33048268 AGCAGGGGATGAAGAGAAGTTGG + Intergenic
988785021 5:34558491-34558513 AAGAGAGGAAGGAGAGAAGAAGG + Intergenic
989026899 5:37078187-37078209 AGGAGGGGAGGGAGAGAATCAGG - Intergenic
989187617 5:38640408-38640430 GGGTGGGGCTTGAGAGAAGAAGG - Intergenic
989210098 5:38850393-38850415 AGGAAGAGAGGGAGAGAAGAAGG - Intronic
989234720 5:39133402-39133424 CGGAGGTGTTGGAGGAAAGAAGG + Intronic
989279155 5:39621748-39621770 CGGAGAGGATGGAGAGACAAAGG - Intergenic
989992455 5:50783167-50783189 AGGAGGGAAAAGAGAGAAGAGGG + Intronic
990210486 5:53478624-53478646 AGGGAGGGAAGGAGAGAAGAGGG + Intergenic
990532121 5:56684516-56684538 ATGAGGGGATGGAGAGAATGTGG - Intergenic
990846175 5:60142207-60142229 CGGATGGGAGGGAGAGAGGGAGG + Intronic
990864259 5:60363363-60363385 TGGAAGGGATGGAAAGAATAGGG - Intronic
990923056 5:60989267-60989289 TGGAGGGGTTATAGAGAAGAGGG + Intronic
991180799 5:63748438-63748460 TGGAGAGGATGGGGAGAAGTAGG + Intergenic
991337634 5:65566730-65566752 AGGGAGGGAGGGAGAGAAGAAGG - Intronic
992016155 5:72577314-72577336 GGGAGGGGGTGGAGCCAAGATGG + Intergenic
992183934 5:74225738-74225760 GGAAGGGGAGGGAGGGAAGAAGG - Intergenic
992447958 5:76850750-76850772 TGGAGGGGCTGGGGAGAAGTTGG + Intronic
992658635 5:78935952-78935974 AGGAAGGGAAGGAGAGAAGGGGG - Intronic
992873171 5:81026064-81026086 AGGAAGGGAGGGAGAGAGGAAGG - Intronic
992911673 5:81401313-81401335 CGGAGGGGAAGGGAAGGAGAAGG + Intergenic
993095383 5:83473478-83473500 GGGAAGGGAGGCAGAGAAGATGG - Intronic
993604460 5:89971269-89971291 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
994287784 5:97991310-97991332 AGGAGGGGGTGGAGAAAAGAAGG + Intergenic
994356947 5:98803356-98803378 AGGAAGGGAGGGAGAGAAGGAGG + Intergenic
994961705 5:106613713-106613735 CGGTAGGGATGGAGAGAGAATGG + Intergenic
994997229 5:107079140-107079162 GGGAGGAGAGGGAGAGAAAAGGG + Intergenic
995368891 5:111396058-111396080 AGGAAGGGAGGGAGAGAGGAGGG + Intronic
995390059 5:111630479-111630501 AAGGGGGGATGGAGAGAAAAAGG + Intergenic
995565061 5:113425860-113425882 GGAAGTGGATGGAGGGAAGATGG + Intronic
995931674 5:117454076-117454098 TGGAGAGGATGCAGAGAAAAGGG - Intergenic
996224198 5:120970233-120970255 TGGAGAGGATGGAGAGAAATAGG + Intergenic
996369506 5:122738360-122738382 TGGAGGGCATGGAGCCAAGAAGG - Intergenic
996900431 5:128537589-128537611 CGCCGGCGATGGGGAGAAGACGG - Exonic
996906086 5:128601933-128601955 TGGAGAGGATGTAGAGAAAAGGG - Intronic
997018342 5:129964390-129964412 AGGAGAAGATGAAGAGAAGAGGG + Intronic
997076049 5:130678918-130678940 AGGAAGGGAGGGAGAGAAAAAGG + Intergenic
997347721 5:133204140-133204162 TGGAGGGGTGGGAGAGAACATGG + Intronic
998192834 5:140042184-140042206 GGTTGGGGTTGGAGAGAAGAAGG - Intronic
998203989 5:140146242-140146264 CGGAGGGGAGGGAGGGGAGCTGG - Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999184749 5:149698797-149698819 CGGAAGGGAGGAAGAAAAGACGG + Intergenic
999233061 5:150073642-150073664 TGAAGGGGGTGGTGAGAAGAGGG - Intronic
999343817 5:150797208-150797230 AGGAGGGGAAGGAGAGTAGAAGG + Intergenic
999384448 5:151144515-151144537 GGGAAGGGATGCGGAGAAGAGGG + Intronic
999475621 5:151895938-151895960 AGGAGGGGCTGGAGAGAGTACGG - Intronic
999671975 5:153966083-153966105 GGGAGATGATGGAGAGAAGAGGG + Intergenic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
999837803 5:155393283-155393305 CGAAGGGAAAGGAGAGAGGAAGG + Intergenic
999843879 5:155457452-155457474 AGAAGGAGAGGGAGAGAAGAGGG - Intergenic
999946362 5:156600305-156600327 GGGAGGGGATGGAGGAGAGAAGG - Intronic
1000101999 5:158025191-158025213 AGGAGGTGATGGTAAGAAGATGG - Intergenic
1000301442 5:159960212-159960234 TGGAAAGGATGGAGAGAAAAGGG + Intronic
1000322363 5:160144732-160144754 CGGTGAGGATGCAGAGAAAAGGG - Intergenic
1000495745 5:161982167-161982189 TGGAGGGGATGTGGAGAAAAGGG - Intergenic
1000520999 5:162294170-162294192 AGGAAGGGATGGAGGGAAGGAGG + Intergenic
1000573772 5:162949976-162949998 GGGAGGGGAAGGAGTGAAGAGGG + Intergenic
1000885691 5:166744836-166744858 TGGAGGGGAATGAGAGAAGAGGG + Intergenic
1000984930 5:167855956-167855978 AGGAGGGAAGGGAGGGAAGAAGG + Intronic
1001141519 5:169147905-169147927 AGGAGGGGGCAGAGAGAAGACGG - Intronic
1001200997 5:169716669-169716691 TGGAGGAAATGGGGAGAAGAAGG - Intronic
1001376165 5:171260519-171260541 GGGAGAGGATGAAGAGAAGTAGG + Intronic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1001774722 5:174320544-174320566 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1001774743 5:174320604-174320626 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1001774766 5:174320668-174320690 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1001774811 5:174320798-174320820 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1001919376 5:175588522-175588544 GGGAGGAGAGGGAGGGAAGAAGG + Intergenic
1001959392 5:175871298-175871320 GGGAGGGGAGCGAGAAAAGAGGG + Intronic
1002026078 5:176397132-176397154 CGGAGGAGATGGAGATAAGGAGG - Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002102360 5:176863791-176863813 AGGAGGGGAAGGAGGGAAGAAGG - Intronic
1002297860 5:178241357-178241379 CAGAGGGGATGTGGGGAAGAGGG + Intronic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003712896 6:8613560-8613582 CTAAGGGGAGGGAGAGGAGACGG - Intergenic
1003759450 6:9160412-9160434 TGGAGAGGATGTAGAGAAAAAGG + Intergenic
1004704717 6:18113842-18113864 TGGAGAGGATGTAGAGAAAAAGG + Intergenic
1004738603 6:18433553-18433575 CTGAGTGGAGGGAGAAAAGACGG + Intronic
1005091999 6:22066952-22066974 AGGAAAGGATGGAGAGAAGAAGG - Intergenic
1005149818 6:22735998-22736020 AGGAAGGGAGGAAGAGAAGACGG - Intergenic
1005763689 6:28989930-28989952 GGGAGGGTATGGAGAGGATAAGG + Intergenic
1006185073 6:32176950-32176972 GGGAGTGGAGGAAGAGAAGAGGG - Exonic
1006202427 6:32306733-32306755 AGGAAGGGAAGGAGAGAAGGAGG - Intronic
1006402348 6:33825187-33825209 AGGAGGGGACAGAGAGGAGAGGG - Intergenic
1006410534 6:33870953-33870975 GGGAGGGGCTGGAGAGGGGAAGG - Intergenic
1006576903 6:35053240-35053262 AGGAGGGGAAGAAGAGAAGGTGG + Intronic
1006719817 6:36142877-36142899 TGGAGGGGGTGGGGAGTAGAGGG + Intronic
1006854583 6:37124087-37124109 CAGAGGGGAAGGGGAGCAGAGGG + Intergenic
1006854589 6:37124103-37124125 CAGAGGGGAAGGGGAGCAGAGGG + Intergenic
1007019735 6:38507487-38507509 TGGATGGTATGGAGAGAAGAGGG - Intronic
1007136602 6:39528105-39528127 AGGAGGGGATAGGGAGATGATGG - Intronic
1007292302 6:40797044-40797066 AGGAGGGGAGGGAGAGAAGCTGG - Intergenic
1007339436 6:41181157-41181179 AGAGGAGGATGGAGAGAAGAAGG - Intergenic
1007341591 6:41194234-41194256 AGGAGGGGCAGGAGAGAGGAGGG - Intronic
1007408631 6:41648960-41648982 GGGAGAGGAGGGAGGGAAGAAGG - Intronic
1007533551 6:42564301-42564323 GGGAGGAGGAGGAGAGAAGATGG + Exonic
1007781050 6:44254960-44254982 CGGAGCAGATGGAGAGTAGCAGG + Exonic
1007815151 6:44517267-44517289 TGGAGAGGATGCAGAGAAAAGGG - Intergenic
1007924895 6:45642929-45642951 GGGAGGGGAGAGAGAGGAGAAGG - Intronic
1007924906 6:45642961-45642983 AGGAGGAGATAGAGAGGAGAAGG - Intronic
1008114007 6:47526286-47526308 CGGAGGAGTTCCAGAGAAGAAGG + Intronic
1008245769 6:49171034-49171056 AAGAGGGGATGGAGAGGAGGTGG + Intergenic
1008288412 6:49682815-49682837 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
1009465414 6:63962617-63962639 CGGAGAGGATGTGGAGAAAAAGG + Intronic
1009546675 6:65029794-65029816 CAGAGCGGATGGAAAGAAGATGG + Intronic
1009751234 6:67881507-67881529 GGGATGGTATGGAGAGATGATGG + Intergenic
1009761533 6:68012969-68012991 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1010059267 6:71603906-71603928 GGGAGAGGAGGGAGAGAGGAGGG - Intergenic
1010168160 6:72941499-72941521 AGGAAGGGAGGGAGAGAAAAAGG - Intronic
1010367015 6:75062740-75062762 TGGAGGTGATGGGGACAAGATGG - Intergenic
1010566501 6:77420815-77420837 GGGAGGGGATGGAGAGATATTGG + Intergenic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1011445242 6:87432441-87432463 AGGAGGGGAGGGAGAGAGGGAGG - Intronic
1011602302 6:89070883-89070905 AGGAAGGGAGGGAGAGAGGAAGG + Intergenic
1011656285 6:89555035-89555057 AGGAGAGGATGGAGAGAAAGCGG - Intronic
1011742610 6:90377633-90377655 AGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1012475793 6:99613802-99613824 CCGGGGGGACGGAGAGCAGAGGG - Exonic
1012569318 6:100702211-100702233 AGGAGGGAATGGAGAGAAATGGG + Intronic
1012671999 6:102064296-102064318 AGGAGGAGAAGGAGAGGAGAAGG - Intronic
1013123275 6:107159310-107159332 CGGAAGGGAGGGAGGGAAGGAGG + Intronic
1013201151 6:107897002-107897024 AGGGAGGGAAGGAGAGAAGAAGG + Intronic
1013341706 6:109221568-109221590 GGGAGGGGAAGGGGAGAGGAAGG - Intergenic
1013384419 6:109610935-109610957 TGGAGGGGATGGAGAAAAGGTGG + Intronic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1013661211 6:112298960-112298982 CGGCTGGGAGGGAGAGGAGAAGG - Intergenic
1013724741 6:113080133-113080155 GGGAGGGAAGAGAGAGAAGAAGG + Intergenic
1013761597 6:113524824-113524846 CAGAGGGTAATGAGAGAAGAAGG + Intergenic
1014495237 6:122113634-122113656 GGGAGGGGATGGAGAAACAAGGG - Intergenic
1014677013 6:124379207-124379229 GGGAGGGAAAGGAGGGAAGAGGG + Intronic
1014999177 6:128192895-128192917 AGGAAGGGAGGAAGAGAAGAAGG + Intronic
1015093327 6:129385141-129385163 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
1015495984 6:133883872-133883894 CAGAGGAAATGGTGAGAAGAGGG + Intergenic
1015653293 6:135487795-135487817 AGGAAGGGATGAAGAGAAGTTGG - Intronic
1015857460 6:137640587-137640609 CAAAGGGAATAGAGAGAAGAGGG - Intergenic
1016085114 6:139903927-139903949 TGGGGGGGATGGAGAGGAAAGGG - Intergenic
1016245908 6:141980586-141980608 GGGAGGGGAAGGAGAAGAGAAGG + Intergenic
1016339650 6:143049391-143049413 GGCAGAGGATGGAGAGAGGATGG - Intergenic
1016455978 6:144231208-144231230 AAGAGAGGATGGTGAGAAGAGGG + Intergenic
1016772823 6:147870821-147870843 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1016785355 6:148005512-148005534 AGGAGGGGAAGGAAGGAAGAGGG + Intergenic
1016804967 6:148203373-148203395 AGGAAGGGAGGGAGAGAAGACGG - Intergenic
1017003208 6:150010361-150010383 AGAAGGGGATGGAGAGAGTAAGG + Intergenic
1017006066 6:150028806-150028828 GGGAAGGGAAGGAGAAAAGAAGG + Intergenic
1017012817 6:150074370-150074392 AGAAGGGGATGGAGATAATAAGG + Intergenic
1017190840 6:151651040-151651062 TGGAGGAGAAGGAGAAAAGAAGG - Intergenic
1017790279 6:157792095-157792117 AGGAAGGGATGGAGGGAAGGAGG - Intronic
1018146741 6:160898679-160898701 AGGAGGGGGAGGAGAGGAGAAGG - Intergenic
1018352523 6:162975761-162975783 AAGAAGGGAGGGAGAGAAGAAGG - Intronic
1018368325 6:163144955-163144977 CAGAGGGGATGGGGAAAAGAGGG - Intronic
1018480454 6:164184318-164184340 TGGAGGGGGTGCAGAGATGAAGG + Intergenic
1018834320 6:167471721-167471743 GGGAGGGGCTGGAGTGATGAGGG - Intergenic
1018839441 6:167507893-167507915 GGGAGGGGAAGGGGAGGAGAGGG - Intergenic
1018839470 6:167507960-167507982 GGGAGGGGATGGGAAGGAGAGGG - Intergenic
1018839486 6:167508009-167508031 GGGAGGGGATGGGGAGGAGAGGG - Intergenic
1018839508 6:167508058-167508080 GGGAGGGGATGGGGAGGGGAGGG - Intergenic
1018839583 6:167508232-167508254 GAGAGGGGATGGGGAGGAGAGGG - Intergenic
1018839595 6:167508264-167508286 GGGAGGGGAAGGGGAGGAGAGGG - Intergenic
1018839767 6:167508722-167508744 GAGAGGGGATGGGGAGGAGAGGG - Intergenic
1018839827 6:167508899-167508921 GGGAGGGGATGTGGAGGAGATGG - Intergenic
1018839848 6:167508963-167508985 GGGAGAGGATGGGGAGGAGATGG - Intergenic
1018914032 6:168121825-168121847 AGGAAGGGTTGGAGAGAGGAAGG + Intergenic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019264595 7:106792-106814 TGGAGGGAATGAAGAGAAGGTGG + Intergenic
1019324172 7:429945-429967 CGGAGGCGATGGAGGGAGGCAGG - Intergenic
1019345208 7:526416-526438 TGCAGGGGTTGGAGAGAGGAAGG - Intergenic
1019671215 7:2280043-2280065 AGGAGGGAGGGGAGAGAAGAAGG + Intronic
1019705406 7:2495018-2495040 TGGAGGGGATGGCGAGAACAAGG - Intergenic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1019879971 7:3850224-3850246 AGGATTGGATGCAGAGAAGAAGG - Intronic
1019908578 7:4083592-4083614 GAGAAGGGAGGGAGAGAAGAAGG - Intronic
1020442012 7:8227352-8227374 CAGAGAAGATGGAGAGAGGAAGG + Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1020654992 7:10918319-10918341 CGGAGGGAGTGGAGAGGAAAGGG - Intergenic
1020885703 7:13816848-13816870 ATCAGGGGAAGGAGAGAAGAGGG - Intergenic
1021127755 7:16872959-16872981 TGGTGAGGATGCAGAGAAGAGGG + Intronic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1021545464 7:21808515-21808537 GAGAGGGGATGCAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022019234 7:26382371-26382393 AGGAGGGGAGGGAGAGTGGAGGG + Intergenic
1022070438 7:26908494-26908516 CGGAGGGGAAGGGGAGGGGAGGG + Intronic
1022351797 7:29573111-29573133 TTGAGGGGTTGGAGAGAAAAGGG - Intergenic
1022381339 7:29862806-29862828 AGGTGGGGAAGAAGAGAAGAGGG - Intronic
1022527844 7:31049838-31049860 GGGTGGGGAGGCAGAGAAGAGGG + Intergenic
1022548893 7:31217651-31217673 CTGAGGAGAGGGAGAGATGAGGG + Intergenic
1022918441 7:34985679-34985701 TGGAGAGGATGTGGAGAAGAGGG + Intronic
1023280328 7:38562663-38562685 AAGAGGGGAGGGAGAGGAGAGGG + Intronic
1023341682 7:39227975-39227997 AGGAAGGGAAGGAGAGAGGACGG + Intronic
1023638510 7:42236853-42236875 GGGACGGGATGGAGTGAAAATGG - Intronic
1024046223 7:45587432-45587454 CGGTGGGGTTAGAGAGAAGTTGG + Intronic
1024131190 7:46354588-46354610 CGGTGAGGAAGGAGAGAAGCAGG + Intergenic
1024268246 7:47622768-47622790 GGGAGGGAATGGAGACAGGAAGG - Intergenic
1024471288 7:49770781-49770803 GGGAAGGGAAGGAGAGAGGAAGG + Intergenic
1024518865 7:50285154-50285176 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1024725476 7:52189397-52189419 GGGAGGGGAGGGGGAGGAGAAGG + Intergenic
1025921307 7:65915593-65915615 TGCAAGGGATGGAGAGACGAAGG - Intronic
1026162653 7:67883283-67883305 GGAAGGGGAGGGAGAGAAGGAGG - Intergenic
1026576991 7:71580692-71580714 TGCAGGGGATGAAGAGAAGTGGG + Intronic
1026762524 7:73137678-73137700 GGGAGGGGAGGGAGAGGGGAAGG + Intergenic
1026762547 7:73137723-73137745 GGGAGGGGAGGGAGAGGGGAAGG + Intergenic
1026762566 7:73137768-73137790 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1026762574 7:73137790-73137812 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1026762582 7:73137812-73137834 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1026762590 7:73137834-73137856 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1026762598 7:73137856-73137878 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1026762608 7:73137878-73137900 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1026886297 7:73949379-73949401 TGGAGGAGAAGGAGAGGAGAAGG - Intergenic
1026955054 7:74371755-74371777 GGGAGGAGAAGGAGAGAGGAGGG + Intronic
1027038987 7:74947454-74947476 GGGAGGGGAGGGAGAGGGGAAGG + Intergenic
1027039010 7:74947499-74947521 GGGAGGGGAGGGAGAGGGGAAGG + Intergenic
1027039029 7:74947544-74947566 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1027039037 7:74947566-74947588 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1027039045 7:74947588-74947610 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1027039053 7:74947610-74947632 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1027039061 7:74947632-74947654 GGGAGGGGAAGGAGAGGAGAAGG + Intergenic
1027039071 7:74947654-74947676 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1027039081 7:74947676-74947698 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1027084570 7:75254712-75254734 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084580 7:75254734-75254756 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084590 7:75254756-75254778 GGGAGGGGAAGGAGAGGAGAAGG - Intergenic
1027084598 7:75254778-75254800 GGGAGGGGAAGGAGAGGAGAAGG - Intergenic
1027084606 7:75254800-75254822 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084616 7:75254822-75254844 GGGAGGGGAAGGAGAGGAGAAGG - Intergenic
1027084624 7:75254844-75254866 GGGAGGGGAAGGAGAGGAGAAGG - Intergenic
1027084632 7:75254866-75254888 GGGAGGGGAAGGAGAGGAGAAGG - Intergenic
1027084640 7:75254888-75254910 GGGAGGGGAAGGAGAGGAGAAGG - Intergenic
1027084648 7:75254910-75254932 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084658 7:75254932-75254954 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084677 7:75254977-75254999 GGGAGGGGAGGGAGAGGGGAAGG - Intergenic
1027084700 7:75255022-75255044 GGGAGGGGAGGGAGAGGGGAAGG - Intergenic
1027261507 7:76468057-76468079 CGGGGGGAATGGAGAGAGGAGGG + Intronic
1027312888 7:76966166-76966188 CGGGCGGAATGGAGAGAGGAGGG + Intergenic
1027464947 7:78503621-78503643 AGGAGGGGAGGGAGAGGAGTGGG - Intronic
1028618898 7:92801978-92802000 GGGAGGGGAAGGAAAGGAGAAGG - Intronic
1029148765 7:98465498-98465520 GCAAAGGGATGGAGAGAAGAGGG - Intergenic
1029205527 7:98867456-98867478 GGGAGGGGATGGGGAGGAGAGGG - Intronic
1029426054 7:100494493-100494515 GGGAGTGGACCGAGAGAAGAAGG + Exonic
1029435531 7:100562187-100562209 GGGAGGGGCAGGAGAGCAGATGG - Intronic
1029444007 7:100603025-100603047 GGGAGGGGGTGGAGAGATGGAGG - Intronic
1029449650 7:100633592-100633614 CGGAGGAGAGGGAGGGAAGAGGG + Intronic
1030266597 7:107628458-107628480 GGAGGGGGATGGAGAGGAGAAGG + Intronic
1030333934 7:108303379-108303401 CAGAGGGGCTGAAGAGGAGACGG - Intronic
1030509049 7:110460516-110460538 GGGAGGAGAAGGAGAGGAGAAGG + Intergenic
1030566483 7:111164126-111164148 GGGAGGAGAGGGAGAGAGGAAGG + Intronic
1030632632 7:111912610-111912632 AGGAGGAGAAGGAAAGAAGATGG + Intronic
1031158467 7:118138129-118138151 TGGAGAGGATGTAGAGAAAAGGG + Intergenic
1031168467 7:118260682-118260704 AGGAAGGGAGGGAGAGAAGGAGG - Intergenic
1032402127 7:131630799-131630821 TGAAGGGGAGGGAGAGAAGAGGG - Intergenic
1032523316 7:132562106-132562128 AGGAGGAGAAGGAGAGAAGGAGG - Intronic
1032523320 7:132562126-132562148 AGGAGGAGAAGGAGAGAAGGAGG - Intronic
1032523324 7:132562146-132562168 AGGAGGAGAAGGAGAGAAGGAGG - Intronic
1032661378 7:133987482-133987504 AAGCGGGGAGGGAGAGAAGAAGG + Intronic
1032773477 7:135084977-135084999 TGGAGAGGATGTAGAGAAAAGGG - Intronic
1032805249 7:135347853-135347875 CAGAGGGGATGGAGAGGATATGG - Intergenic
1033180727 7:139175191-139175213 TGGAGAGGATGTAGAGAAAAGGG + Intronic
1033235705 7:139636327-139636349 CTGGGTGGAAGGAGAGAAGACGG - Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033821444 7:145139124-145139146 CGGAGGGGTTAGGGAGGAGAGGG + Intergenic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1033966934 7:146986637-146986659 TGGCGTGGATGGAGTGAAGAGGG - Intronic
1034194054 7:149232496-149232518 CGGAAGGGAGGGAGGGAGGAAGG - Intergenic
1034252893 7:149706543-149706565 AGGGGGGGAAGGAGAGGAGAGGG - Intergenic
1034416220 7:150965587-150965609 GGGAGGAGTTGGAGGGAAGAGGG - Intronic
1034427931 7:151024256-151024278 GGCAGGGGACAGAGAGAAGATGG + Exonic
1034487570 7:151375591-151375613 AGGAAGGGATGGAGAGCAGGTGG - Intronic
1034740391 7:153468081-153468103 TTGAGGGGATGGAGAAAAGGTGG - Intergenic
1034895697 7:154875155-154875177 AGGAGGGGAGGGAGGGAGGAAGG + Intronic
1035120233 7:156560626-156560648 CGGAGGAGATGGAGACAGGGAGG - Intergenic
1035515922 8:232314-232336 GGGAGGGGAGGCAGAGAAAAAGG - Intronic
1035533347 8:372702-372724 TGGAGGGGGTGGAGCCAAGATGG - Intergenic
1035613089 8:981558-981580 CGGAGAGGATGCAGAGAAACTGG - Intergenic
1035673707 8:1439701-1439723 CCTAGGGGATGGCGGGAAGAAGG - Intergenic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035775798 8:2187040-2187062 TGGAAAGGATGGAGAGAAGATGG + Intergenic
1035775807 8:2187106-2187128 TGGAAAGGATGGAGAGAAGATGG + Intergenic
1035775815 8:2187172-2187194 TGGAAAGGATGGAGAGAAGATGG + Intergenic
1035775824 8:2187238-2187260 TGGAAAGGATGGAGAGAAGATGG + Intergenic
1035775835 8:2187304-2187326 TGGAAAGGATGGGGAGAAGATGG + Intergenic
1035775845 8:2187370-2187392 TGGAAAGGTTGGAGAGAAGATGG + Intergenic
1035775855 8:2187436-2187458 TGGAAAGGATGGAGAGAAGATGG + Intergenic
1035825641 8:2641842-2641864 CTGAGAGGATGGAGTGAAGGAGG + Intergenic
1035862010 8:3039297-3039319 AGGAAGGGAGGGAGAGAGGAAGG - Intronic
1036207491 8:6815768-6815790 GGGAGGGGATGCAGAGAAGAAGG + Intronic
1036208642 8:6824304-6824326 AGGTGGGGAGGGAGAGAAGGGGG + Intronic
1036279024 8:7383322-7383344 TGGAGGGGAAAGAGAGAAGGAGG - Intronic
1036342496 8:7928552-7928574 TGGAGGGGAAAGAGAGAAGGAGG + Intronic
1036477172 8:9103899-9103921 TAGAAGGGATGGAGAGAAAAAGG - Intronic
1036546120 8:9771456-9771478 AAGAAGGGAGGGAGAGAAGAAGG + Intronic
1036561544 8:9903762-9903784 CGGAGGGGGTGGAGGGATGGGGG + Intergenic
1036605456 8:10301781-10301803 AGGAGGGGCTGGGGAGAAAAAGG + Intronic
1036950400 8:13133803-13133825 CGGAGGGGAAGCGGAGAGGAAGG + Intronic
1037376126 8:18230987-18231009 AGGTGGGGATGTAGAGAAGGTGG + Intergenic
1037480613 8:19302036-19302058 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1037673784 8:21037399-21037421 GGCAGGGAAAGGAGAGAAGAGGG + Intergenic
1037752841 8:21693781-21693803 GAGAGGGGAAGGAGAGAGGAAGG + Intronic
1038307926 8:26421347-26421369 GGGAGGGGGTGGAGAGAAAAAGG + Intronic
1038379248 8:27076892-27076914 CGAGAGGGAGGGAGAGAAGAAGG + Intergenic
1038689320 8:29746696-29746718 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1038761037 8:30384470-30384492 CGGAGAGGAGGGAGGGGAGAGGG + Intronic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039440242 8:37590062-37590084 CGGAGTGGATGTGGAGCAGAAGG - Intergenic
1039481810 8:37879442-37879464 AGGAGGGGAAGGAGAGAATGAGG + Intronic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1039845473 8:41322450-41322472 GGGAGGGGAGAGAGAGAGGAGGG + Intergenic
1039870350 8:41540490-41540512 TGGAGGGTGTGGAGAGAGGAGGG + Intronic
1040445972 8:47494003-47494025 GTGAGGGGAAGGAGAAAAGAAGG - Intronic
1040734845 8:50492372-50492394 CGGAGAGGATGTGGAGAAGTAGG - Intronic
1040970318 8:53128930-53128952 TGGAGGGGAAGGTGAGGAGAGGG + Intergenic
1041306397 8:56465449-56465471 AGGAGGGGAGGCAGAGAGGAGGG - Intergenic
1041525021 8:58795749-58795771 AGGAAGGGAGGGAGAGGAGACGG - Intergenic
1041753561 8:61288261-61288283 CGGGAGGGATGGAGTGCAGAGGG - Intronic
1041779660 8:61563854-61563876 TGGAAGGGATGGGGAGCAGATGG - Intronic
1041888519 8:62841940-62841962 TGGAGAGGATGTAGAGAAAAGGG - Intronic
1041953628 8:63533180-63533202 AGGAAGGGAGGGAGGGAAGAGGG - Intergenic
1041992033 8:64005000-64005022 CTGAGGGGTGGGAGAGAAAATGG - Intergenic
1042319225 8:67457532-67457554 CAGAGAGGATGGAAAGAAGAAGG - Intronic
1042361979 8:67893940-67893962 TGGAGGGGGTGGAGCCAAGATGG + Intergenic
1043061846 8:75515558-75515580 TGAAGGGGAGGGAGAGAAGCAGG + Intronic
1043322674 8:79009416-79009438 GGGAAGGGAGGGAGGGAAGAGGG - Intergenic
1043356867 8:79423991-79424013 GAGAGAGGATGGAGAGAGGAAGG + Intergenic
1043372558 8:79611709-79611731 GGGAGGGGATGGAGAGAACTGGG + Intronic
1043692634 8:83174656-83174678 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1043701620 8:83295202-83295224 GGGAGAGGATGGAGAAAAGTGGG - Intergenic
1043708518 8:83382476-83382498 GGGAGGGGAGGGAAAGGAGAGGG + Intergenic
1044009145 8:86970597-86970619 CAGGTGGGAGGGAGAGAAGAGGG - Intronic
1044526397 8:93256542-93256564 AGGAGGATATGAAGAGAAGATGG + Intergenic
1044613675 8:94118758-94118780 CTGAGGGGATGGAGAAAAATGGG + Intergenic
1044662055 8:94600970-94600992 GGGAGGGGAGGGAGAAAGGAAGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044952391 8:97447021-97447043 AGGAAGGGAGGAAGAGAAGAAGG - Intergenic
1045262123 8:100585382-100585404 AGGGGAGGATGGAGAGGAGAAGG + Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045520465 8:102898659-102898681 CTGGGAGGAAGGAGAGAAGAGGG + Intronic
1045583286 8:103501084-103501106 CGGAGGGCAGGGAGAGAGGCGGG - Intronic
1045718315 8:105074893-105074915 CGGGAGGGAGGGAGGGAAGAAGG - Intronic
1045789373 8:105964100-105964122 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1046023910 8:108699220-108699242 AGGAAGGGAGGGAGAGAAGGAGG - Intronic
1046066808 8:109207137-109207159 AGTAGGGGATGGAGGGAGGAGGG + Intergenic
1046126062 8:109910178-109910200 GGGAAGGGAAGGAAAGAAGAAGG - Intergenic
1046145942 8:110158606-110158628 AGGAGGGGAGGGAAAAAAGAAGG - Intergenic
1046231160 8:111360598-111360620 TGGAGAGGATGGAGAAAATATGG + Intergenic
1046383859 8:113484296-113484318 TGGAGAGGATGTGGAGAAGATGG - Intergenic
1046493209 8:114980711-114980733 GGGAGGGGAAAGAGAGAAGTCGG - Intergenic
1046494765 8:114998976-114998998 GGGAGGGGAGGGAGAAAGGAAGG - Intergenic
1046561441 8:115842760-115842782 AGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1047135956 8:122078709-122078731 GGGAAGGGAGGGAGGGAAGAGGG + Intergenic
1047293506 8:123551098-123551120 TGAAGGGGGTGGAGAAAAGAGGG + Intergenic
1047305663 8:123651122-123651144 AGGAAGGGAGGGAGGGAAGAAGG - Intronic
1047798664 8:128285588-128285610 GGGAGGGGAAGAAGAGGAGAGGG + Intergenic
1047954438 8:129962668-129962690 CAGAGGGGAGGGATAGAAGAGGG - Intronic
1048323456 8:133420438-133420460 ACTAGGTGATGGAGAGAAGATGG - Intergenic
1048359680 8:133687206-133687228 AGGAGGAGAAGGAGGGAAGATGG - Intergenic
1048363136 8:133715241-133715263 GGGAGGGAAAGGAGAGAAGACGG - Intergenic
1048408069 8:134143084-134143106 TGGAAGGGAGGGAGAGAGGAAGG - Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048516564 8:135116778-135116800 GGGAGGAGGAGGAGAGAAGAAGG - Intergenic
1048771769 8:137902903-137902925 AGGAGGAGAGGGAGAGAAAATGG + Intergenic
1048787111 8:138062358-138062380 CGGAGGGCATGGCCGGAAGAAGG + Intergenic
1048848715 8:138623827-138623849 TCGAGGGGATGGAAAGACGAAGG + Intronic
1048877958 8:138851642-138851664 AGGAGAGGATGGGGAGGAGATGG + Intronic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049231763 8:141488395-141488417 GGGAGGGGAGGGAGAAGAGAGGG - Intergenic
1049251729 8:141592913-141592935 AGGCGGGGATGGAAAGAGGAAGG - Intergenic
1049261332 8:141640767-141640789 GGGAGAGGATGGGGAGGAGAAGG - Intergenic
1049272961 8:141705813-141705835 CGGAGATGATGGGGAGATGATGG + Intergenic
1049273026 8:141706148-141706170 TGGAGGTGATGGGGAGATGATGG + Intergenic
1049284466 8:141767138-141767160 GGGAGGGGAGGGGGAGAGGAAGG - Intergenic
1049302628 8:141879697-141879719 AGGAGGAGAAGGGGAGAAGAGGG - Intergenic
1049422251 8:142522188-142522210 CACAGGGGATGGGGAGAGGAGGG - Intronic
1049501523 8:142970269-142970291 AGGAAGGGATGGAGAAAAGAGGG + Intergenic
1049531165 8:143156303-143156325 GGGAGGTGATGGAGAGGTGAGGG + Intergenic
1049937559 9:514143-514165 AGGAAGGGAGGGAGAGAGGAAGG - Intronic
1049937564 9:514159-514181 AGGAAGGGAGGGAGAGAGGAAGG - Intronic
1049937569 9:514175-514197 AGGAAGGGAGGGAGAGAGGAAGG - Intronic
1050248637 9:3719491-3719513 TGGAGAGGATGTGGAGAAGAAGG + Intergenic
1050598051 9:7223791-7223813 AGGAAGGGAGGGAGAGAGGAAGG - Intergenic
1052734815 9:32330652-32330674 AGGAGGGGATGAAGAGAAGTTGG + Intergenic
1054454038 9:65420439-65420461 GGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1054542289 9:66278137-66278159 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1054766208 9:69044659-69044681 GGGAGGTGATGGAGCGAGGAGGG - Intronic
1054896830 9:70322953-70322975 GGGAGGGGAGGGAGATAAGTTGG - Intronic
1054901145 9:70370754-70370776 GGGAGGGGAGGGGGAGAGGAAGG + Intergenic
1055467612 9:76581113-76581135 CTGAGAGGATGTAGAGAAAAGGG - Intergenic
1055595092 9:77857658-77857680 AGGAGGGGAAGGAGGGAAGGAGG + Intronic
1055804329 9:80076137-80076159 GGTGGGGGATGGAGAGAAGGAGG - Intergenic
1056100137 9:83293173-83293195 AGGAGGGGAGGGAGGGAGGAAGG + Intronic
1056175769 9:84033912-84033934 TGGAGAGGATGTAGAGAAAAGGG - Intergenic
1056531179 9:87489232-87489254 AGGAGGGGGTGGAGTGAAGGTGG + Intergenic
1056897272 9:90562697-90562719 GAGAAGGGAGGGAGAGAAGAAGG - Intergenic
1056955868 9:91080629-91080651 TGGAGAGGATGCAGAGAAGCTGG + Intergenic
1057167403 9:92939977-92939999 AGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1057496281 9:95563910-95563932 AGGAAGGAAGGGAGAGAAGAAGG - Intergenic
1057511457 9:95683099-95683121 TGGAGAGGATGTAGAGAAAACGG + Intergenic
1057565084 9:96160213-96160235 GGGAGGGAAGGGAGAGAAGAAGG + Intergenic
1057574134 9:96227777-96227799 AGTGGGGGATGGGGAGAAGATGG + Intergenic
1057602753 9:96472774-96472796 TGGAGGGGAGGAAGTGAAGAAGG - Intronic
1057914820 9:99047610-99047632 CGGAGAGGCTGGAGACAAGGAGG + Intronic
1058466727 9:105236352-105236374 TTTGGGGGATGGAGAGAAGACGG + Intergenic
1058478614 9:105367757-105367779 CAGAGGGGCTGGGGTGAAGAGGG - Intronic
1058526884 9:105867960-105867982 AGGAGGGGATGGGGAGATGTTGG - Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1059154348 9:111976678-111976700 AGGAAGGAATGGAGAGAAGGAGG + Intergenic
1059427202 9:114228494-114228516 TGGAGAGGAGGGAGAGAAGCCGG - Intronic
1059710956 9:116867260-116867282 CCGAGGAGAGGGAGAGAAGGTGG + Intronic
1059723687 9:116985866-116985888 AGGAAGGCATGGAGAGCAGAGGG + Intronic
1059820652 9:117968659-117968681 TGGGGGAGATGGAGAGAACAAGG + Intergenic
1059835354 9:118146182-118146204 AGGAATGGATGGAGAGAGGAAGG - Intergenic
1060025605 9:120168228-120168250 GGGTGGGTATGCAGAGAAGAGGG - Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060122852 9:121011483-121011505 TGGAGGGGATGTGGAGAAAAGGG + Intronic
1060256443 9:122035126-122035148 AGGAGAGGTTGGAGAGAGGAGGG - Intronic
1060273414 9:122164251-122164273 GGGAGGAGAAGGAGAGAAGGAGG + Intronic
1060353553 9:122881668-122881690 GGGTGGGGATGGAGAGGACAGGG + Intronic
1060382999 9:123194392-123194414 AGGAGAGGAAAGAGAGAAGAGGG - Intronic
1060399648 9:123340740-123340762 AGGTGGGGATGGAAAGAAGAAGG + Intergenic
1060871984 9:127050165-127050187 AGGAGGTGTGGGAGAGAAGAGGG - Intronic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061259348 9:129471252-129471274 AGGAGGGCATTGAGAGAGGAGGG + Intergenic
1061390532 9:130315181-130315203 GGGAGGGGAGGGAGGGAGGAAGG - Intronic
1061578460 9:131522461-131522483 GGGAGGGGATGAAGAGATGTGGG + Intronic
1061724962 9:132577252-132577274 GGGGAGGGATGGAGAGAGGAAGG + Intergenic
1061865691 9:133490846-133490868 AGGAGGGGAGGGGGAGAAGGAGG + Intergenic
1061947129 9:133914696-133914718 GGGAGGGGAAGGAGAGGGGAGGG + Intronic
1062082900 9:134633886-134633908 CTGAGGGGCTGGAGACAGGAGGG - Intergenic
1062113335 9:134794746-134794768 AGGAGGGGAAGGAGGGAGGAAGG + Intronic
1062165385 9:135104991-135105013 AGAAAGGGATGGAGAGGAGATGG - Intronic
1062201670 9:135306132-135306154 GGAAGGGGAGGGAGGGAAGAAGG - Intergenic
1062386092 9:136312075-136312097 CGGAGAGGATGTAGAAATGAGGG - Intergenic
1203429575 Un_GL000195v1:79186-79208 GGGAGGGGAAGGAGAGCAGCAGG + Intergenic
1185581208 X:1212906-1212928 TGGAGGGGAGGGGGAGGAGATGG - Intergenic
1185699991 X:2223578-2223600 CGAAAGGGATGGAAAGAGGAAGG + Intronic
1185708457 X:2282611-2282633 AAGAGGGGAGGGAGAGAAGAAGG + Intronic
1185830193 X:3294286-3294308 AGGAGGAGAAGGAGAGAAGGAGG - Intergenic
1185850681 X:3483328-3483350 TGGTGGGGATGCAGAAAAGAGGG - Intergenic
1185907054 X:3944835-3944857 AGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1186020644 X:5251309-5251331 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
1186077650 X:5898201-5898223 AGGAGAGGAAGGAAAGAAGAAGG - Intronic
1186155179 X:6717833-6717855 TGGTGAGGATGCAGAGAAGAGGG - Intergenic
1186927468 X:14350905-14350927 CGGAGGGGCTGGTGGGAAGGTGG + Intergenic
1187408888 X:19029840-19029862 CAGAGAGGAGGGAGAGAAGGAGG + Intronic
1187591311 X:20720536-20720558 GGGAGGGGATGGAGAGTGGAAGG - Intergenic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1187915434 X:24149423-24149445 CGGAGGAGGTGGAAAGAAGGGGG + Intronic
1188318717 X:28708816-28708838 GGGAGAGGATGAAGAGAAGTGGG + Intronic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1188945028 X:36290051-36290073 CGGGGAGGAGGAAGAGAAGAGGG - Intronic
1189133222 X:38521932-38521954 CGGAGAGGATGTAGAGAAATAGG - Intronic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189214516 X:39311640-39311662 GGTGGGGGATGGAGAGAAGTGGG - Intergenic
1189286105 X:39853600-39853622 GGGTGGGGAAGGAGAGGAGAAGG + Intergenic
1189348758 X:40261921-40261943 CGGGTGGGCTGGAGACAAGATGG - Intergenic
1189446372 X:41085212-41085234 CGGGGTGGAGGGAGAGAAGAGGG + Intergenic
1189579614 X:42392289-42392311 TGGAGGGGAGGGAGAGAGAAGGG + Intergenic
1189946250 X:46182309-46182331 GGGAGGGGATGGGGAGAGGTTGG + Intergenic
1190055040 X:47176350-47176372 GAGAGCGGATGGAGGGAAGAAGG - Intronic
1190074047 X:47302678-47302700 CGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190585812 X:51940553-51940575 ACTAGAGGATGGAGAGAAGAAGG - Intergenic
1190837937 X:54118583-54118605 CGGAGAGGATGCAGAGAAGCTGG - Intronic
1191042256 X:56095806-56095828 TGGTGGGGATGCAGAGAAAAAGG + Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1191822446 X:65326981-65327003 TGGCAGGGATGGAGAGAAAAGGG + Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1191937728 X:66443037-66443059 AGGAGGGAATGGGGAGAAGAGGG - Intergenic
1192190963 X:68990961-68990983 GGGAGGGGAGGGAGAAAGGAAGG - Intergenic
1192917798 X:75672776-75672798 CGGAGGTGGTGGCTAGAAGAGGG - Intergenic
1193501801 X:82285449-82285471 CGGAGGGAAGGAAGAAAAGAAGG + Intergenic
1193655627 X:84193676-84193698 TGGTGAGGATGGAGAGAAGAGGG - Intergenic
1193782602 X:85722205-85722227 CGGGGGGGATGAAGAGAGGTTGG - Intergenic
1194132631 X:90100704-90100726 CGTGGGGGATGGTGAGGAGAGGG - Intergenic
1194409712 X:93543058-93543080 AGGAGGAGACAGAGAGAAGAGGG + Intergenic
1194680027 X:96841425-96841447 GGAAGGGAATGGAGAGGAGAAGG - Intronic
1195063191 X:101216379-101216401 CGGAGGAGATACAGAGAAAATGG + Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195431176 X:104791215-104791237 GGGTGGGGGTGGAGAGAGGAGGG - Intronic
1195750535 X:108159046-108159068 CTGGGAGGGTGGAGAGAAGAGGG + Intronic
1195910064 X:109880450-109880472 CAGAGGAGATGGGGAGAAGCAGG - Intergenic
1195934620 X:110113023-110113045 CAGAGGGGAGGGAGGGAGGAAGG - Intronic
1196049302 X:111288495-111288517 GGGAGGGGCGGAAGAGAAGAGGG - Intergenic
1196077610 X:111594709-111594731 TGGAGGGGGAGGAGACAAGATGG - Intergenic
1196237566 X:113300029-113300051 GGGAGGGGAGGGGGAGAGGAAGG - Intergenic
1196403549 X:115341153-115341175 AGGATGGGAGGGTGAGAAGAAGG + Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1196939447 X:120761027-120761049 GGGAAGGGAAGGAGAGAGGAGGG - Intergenic
1197151189 X:123221655-123221677 GGGAGGGGATAGAGAGAGGGTGG + Intronic
1197456929 X:126688405-126688427 TGGCGGGGATGTAGAGAAAAGGG + Intergenic
1197707970 X:129647625-129647647 CGGAGGGGACCTGGAGAAGAAGG + Exonic
1197836980 X:130705602-130705624 GGGAGGGAAGGGAGATAAGAAGG - Intronic
1197906072 X:131427248-131427270 AGGAGGGGGAGGAGAGAAGGAGG - Intergenic
1198080802 X:133237420-133237442 CGGTGGGGAGGAAGAGAAGGAGG + Intergenic
1198131302 X:133697920-133697942 CAGAGGGGAAGGAGAGGAGGGGG + Intronic
1198532341 X:137559199-137559221 CGGAGTGGAAGGAAAGATGAAGG + Intergenic
1198657921 X:138934983-138935005 CTGAGGGCAGGGGGAGAAGAGGG - Intronic
1198712742 X:139523551-139523573 TGGAGGGGGTGGAGCCAAGATGG + Intergenic
1198895900 X:141454261-141454283 TGGTGGGGATGTAGAGAAAAGGG + Intergenic
1199051198 X:143239036-143239058 TGGTGGGGATGGGGAGAGGAAGG - Intergenic
1199141017 X:144312522-144312544 TGGAGAGGATGTAGAGAAAAGGG + Intergenic
1199259119 X:145750144-145750166 TGGAGAGGATGTAGAGAAAAGGG + Intergenic
1199811814 X:151357074-151357096 AGGAAGGGACGGAGGGAAGAGGG - Intergenic
1200123698 X:153803358-153803380 CGGTGGTGACTGAGAGAAGAGGG + Exonic
1200478418 Y:3670783-3670805 CGTGGGGGATGGTGAGGAGAGGG - Intergenic
1200908563 Y:8511036-8511058 AGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1202331300 Y:23756278-23756300 TGGAGGGGGTGGAGCCAAGATGG + Intergenic
1202539470 Y:25913782-25913804 TGGAGGGGGTGGAGCCAAGATGG - Intergenic