ID: 1063689918

View in Genome Browser
Species Human (GRCh38)
Location 10:8277116-8277138
Sequence AAGAGGGGCTCCCTAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063689913_1063689918 22 Left 1063689913 10:8277071-8277093 CCGGAACTTGTAGTTTTGGGCAG No data
Right 1063689918 10:8277116-8277138 AAGAGGGGCTCCCTAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063689918 Original CRISPR AAGAGGGGCTCCCTAGCTTC TGG Intergenic
No off target data available for this crispr