ID: 1063693259

View in Genome Browser
Species Human (GRCh38)
Location 10:8307401-8307423
Sequence CATTCTTATGTCAATGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063693255_1063693259 26 Left 1063693255 10:8307352-8307374 CCTTTATCTAAGATGAATTTTGA No data
Right 1063693259 10:8307401-8307423 CATTCTTATGTCAATGCAGGAGG No data
1063693256_1063693259 1 Left 1063693256 10:8307377-8307399 CCTTATGTTCTTTGCTTGTAATG No data
Right 1063693259 10:8307401-8307423 CATTCTTATGTCAATGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063693259 Original CRISPR CATTCTTATGTCAATGCAGG AGG Intergenic
No off target data available for this crispr