ID: 1063697791

View in Genome Browser
Species Human (GRCh38)
Location 10:8354112-8354134
Sequence AGTGCAGGGCATGGTTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063697791_1063697798 -2 Left 1063697791 10:8354112-8354134 CCCTTTGAACCATGCCCTGCACT No data
Right 1063697798 10:8354133-8354155 CTGGGTTTCCACTGTTAAGCAGG No data
1063697791_1063697799 1 Left 1063697791 10:8354112-8354134 CCCTTTGAACCATGCCCTGCACT No data
Right 1063697799 10:8354136-8354158 GGTTTCCACTGTTAAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063697791 Original CRISPR AGTGCAGGGCATGGTTCAAA GGG (reversed) Intergenic
No off target data available for this crispr