ID: 1063697792

View in Genome Browser
Species Human (GRCh38)
Location 10:8354113-8354135
Sequence CAGTGCAGGGCATGGTTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063697792_1063697799 0 Left 1063697792 10:8354113-8354135 CCTTTGAACCATGCCCTGCACTG No data
Right 1063697799 10:8354136-8354158 GGTTTCCACTGTTAAGCAGGTGG No data
1063697792_1063697798 -3 Left 1063697792 10:8354113-8354135 CCTTTGAACCATGCCCTGCACTG No data
Right 1063697798 10:8354133-8354155 CTGGGTTTCCACTGTTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063697792 Original CRISPR CAGTGCAGGGCATGGTTCAA AGG (reversed) Intergenic