ID: 1063703668

View in Genome Browser
Species Human (GRCh38)
Location 10:8410250-8410272
Sequence TCCTCTCGCTGCACTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063703668_1063703676 -1 Left 1063703668 10:8410250-8410272 CCTCCAGGAGTGCAGCGAGAGGA No data
Right 1063703676 10:8410272-8410294 AGAAGGGGCATCCCGGGGATAGG No data
1063703668_1063703677 4 Left 1063703668 10:8410250-8410272 CCTCCAGGAGTGCAGCGAGAGGA No data
Right 1063703677 10:8410277-8410299 GGGCATCCCGGGGATAGGATAGG No data
1063703668_1063703674 -7 Left 1063703668 10:8410250-8410272 CCTCCAGGAGTGCAGCGAGAGGA No data
Right 1063703674 10:8410266-8410288 GAGAGGAGAAGGGGCATCCCGGG No data
1063703668_1063703682 26 Left 1063703668 10:8410250-8410272 CCTCCAGGAGTGCAGCGAGAGGA No data
Right 1063703682 10:8410299-8410321 GATCAGGCATAGTGCACAGGAGG No data
1063703668_1063703679 10 Left 1063703668 10:8410250-8410272 CCTCCAGGAGTGCAGCGAGAGGA No data
Right 1063703679 10:8410283-8410305 CCCGGGGATAGGATAGGATCAGG No data
1063703668_1063703681 23 Left 1063703668 10:8410250-8410272 CCTCCAGGAGTGCAGCGAGAGGA No data
Right 1063703681 10:8410296-8410318 TAGGATCAGGCATAGTGCACAGG No data
1063703668_1063703675 -6 Left 1063703668 10:8410250-8410272 CCTCCAGGAGTGCAGCGAGAGGA No data
Right 1063703675 10:8410267-8410289 AGAGGAGAAGGGGCATCCCGGGG No data
1063703668_1063703673 -8 Left 1063703668 10:8410250-8410272 CCTCCAGGAGTGCAGCGAGAGGA No data
Right 1063703673 10:8410265-8410287 CGAGAGGAGAAGGGGCATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063703668 Original CRISPR TCCTCTCGCTGCACTCCTGG AGG (reversed) Intergenic