ID: 1063714127

View in Genome Browser
Species Human (GRCh38)
Location 10:8510457-8510479
Sequence TTGAATGAGAGTGAAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063714127_1063714130 -9 Left 1063714127 10:8510457-8510479 CCATCCTCTTCACTCTCATTCAA No data
Right 1063714130 10:8510471-8510493 CTCATTCAATTGGACCTTTGAGG No data
1063714127_1063714131 3 Left 1063714127 10:8510457-8510479 CCATCCTCTTCACTCTCATTCAA No data
Right 1063714131 10:8510483-8510505 GACCTTTGAGGTTGAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063714127 Original CRISPR TTGAATGAGAGTGAAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr