ID: 1063714539

View in Genome Browser
Species Human (GRCh38)
Location 10:8514070-8514092
Sequence CAGCTCAGACACCTTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 1, 2: 10, 3: 41, 4: 185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063714528_1063714539 16 Left 1063714528 10:8514031-8514053 CCGCGCCATGTCCTGCTTGACCC 0: 1
1: 6
2: 6
3: 23
4: 124
Right 1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG 0: 1
1: 1
2: 10
3: 41
4: 185
1063714527_1063714539 22 Left 1063714527 10:8514025-8514047 CCGCTGCCGCGCCATGTCCTGCT 0: 1
1: 0
2: 2
3: 13
4: 192
Right 1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG 0: 1
1: 1
2: 10
3: 41
4: 185
1063714532_1063714539 5 Left 1063714532 10:8514042-8514064 CCTGCTTGACCCGCTGCAGGGCG 0: 1
1: 9
2: 11
3: 20
4: 120
Right 1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG 0: 1
1: 1
2: 10
3: 41
4: 185
1063714534_1063714539 -4 Left 1063714534 10:8514051-8514073 CCCGCTGCAGGGCGGCCTCCAGC 0: 12
1: 16
2: 20
3: 49
4: 391
Right 1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG 0: 1
1: 1
2: 10
3: 41
4: 185
1063714529_1063714539 11 Left 1063714529 10:8514036-8514058 CCATGTCCTGCTTGACCCGCTGC 0: 1
1: 13
2: 9
3: 38
4: 201
Right 1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG 0: 1
1: 1
2: 10
3: 41
4: 185
1063714535_1063714539 -5 Left 1063714535 10:8514052-8514074 CCGCTGCAGGGCGGCCTCCAGCT 0: 12
1: 14
2: 7
3: 33
4: 301
Right 1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG 0: 1
1: 1
2: 10
3: 41
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063714539 Original CRISPR CAGCTCAGACACCTTGGTGT TGG Intergenic
901658479 1:10784201-10784223 CACCACAGAGACCTTGGTCTTGG + Intronic
901935195 1:12621810-12621832 CAGCTCAGGGACTTTGGGGTGGG + Intergenic
902323853 1:15685222-15685244 CACCACAGACACCTTGCTGTGGG + Intronic
903364897 1:22800078-22800100 CAGCTCTGACAGCAGGGTGTGGG - Intronic
903651965 1:24928025-24928047 CAGCTCAGTCACTATGATGTGGG + Intronic
903725152 1:25436754-25436776 CAGCTGAGACAATTTGATGTCGG - Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
906708699 1:47913502-47913524 AAGGTCAGACACCTTTGTCTGGG - Intronic
907294061 1:53438591-53438613 CAGCACAGACACCACGGAGTCGG + Intergenic
907312443 1:53546678-53546700 CAGCAGAGGCACCTTGGTGTCGG - Intronic
907820945 1:57967876-57967898 CAGCTCTGACACTTAGCTGTGGG + Intronic
908872945 1:68635363-68635385 CAGCCCAGTAACCTTGCTGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
910626195 1:89310605-89310627 GAGCTCAGACACCTTCGCTTTGG + Intergenic
911658655 1:100475376-100475398 CATCTCTGTCATCTTGGTGTTGG + Intronic
912185831 1:107274868-107274890 CAGCTTAGACACTTTTGTCTGGG + Intronic
912521021 1:110244702-110244724 CAGTGCAGACACCTTGGATTGGG - Intronic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
915973573 1:160370740-160370762 CAACTCAGACACCATGGAGCTGG + Exonic
916446824 1:164880442-164880464 TAGCTGAGACACCAAGGTGTGGG + Intronic
918005027 1:180533947-180533969 CAGAACAGACACCTTGGCTTGGG + Intergenic
921855245 1:219975165-219975187 AGGCTCAGACACCCTGCTGTGGG - Intronic
923135294 1:231111805-231111827 CATCTCTGTCACCTTGGTGCTGG - Intergenic
1063515344 10:6689690-6689712 CAGCTCTGGCACCTTGATCTTGG - Intergenic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1065153834 10:22849676-22849698 GAGCTCAGCCACGTTGGTGCCGG - Intergenic
1067516191 10:46947276-46947298 CACCTCAAAAACCTTGGAGTTGG + Intronic
1067646056 10:48104517-48104539 CACCTCAAAAACCTTGGAGTTGG - Intergenic
1072416705 10:95252569-95252591 CATCTCTGTCATCTTGGTGTTGG - Intronic
1075563209 10:123483321-123483343 CAGTGCAGACACCCTGTTGTGGG - Intergenic
1076801646 10:132833771-132833793 CAGCACAGCCACCTTCGCGTGGG - Intronic
1076872713 10:133201544-133201566 CTGCTCACCCACCTCGGTGTCGG + Exonic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1078186401 11:9055334-9055356 CAGCTCAAAGACCTAGTTGTGGG + Intronic
1078191263 11:9093917-9093939 CAGCCCAGTCACACTGGTGTGGG + Intronic
1078408809 11:11094571-11094593 CAACTCCCACACCTTGGTCTTGG - Intergenic
1084449360 11:69226450-69226472 CATCTCTGTCATCTTGGTGTTGG + Intergenic
1088428457 11:109730780-109730802 CAGTTAAGACACATTGGTGTAGG + Intergenic
1088640399 11:111867366-111867388 CACCTCTGTCATCTTGGTGTTGG - Intronic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1096266907 12:50130749-50130771 AAGCTCAGAGACCCAGGTGTGGG + Intronic
1096334027 12:50739512-50739534 CAGCTCAGACACTCTGGGCTCGG + Exonic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097353405 12:58574086-58574108 CAGTTAAGACACTTTGGTTTGGG + Intronic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1100598268 12:96090105-96090127 CAGATCAGGCACCTTGTTCTTGG - Intergenic
1101233276 12:102763723-102763745 AGGCTCAGACAGCTTGGAGTGGG + Intergenic
1101522309 12:105495324-105495346 TAGCTCAAACAGCTGGGTGTTGG + Intergenic
1102078759 12:110080882-110080904 CAGCTTAGTCTCCTTGATGTTGG - Intergenic
1103464074 12:121128123-121128145 CAGCTTAGTCTCCTTGGTGTTGG + Intergenic
1104628079 12:130376181-130376203 CTGCTCAGACTTCTTGGTCTCGG + Intergenic
1105242392 13:18620031-18620053 CACCTCAGAGTCCTTGGTCTAGG - Intergenic
1105281187 13:18963622-18963644 CAGCTCAGAGAGCCTTGTGTGGG - Intergenic
1105290389 13:19049638-19049660 CAGCTCAGAGAGCCTTGTGTGGG - Intergenic
1105991388 13:25625524-25625546 CTGCTCAAACACATTGATGTTGG - Intronic
1111300404 13:86342125-86342147 CAGCTCAGCCACATTGGAATAGG - Intergenic
1112357617 13:98687431-98687453 GACCTCAGAGACCTTGCTGTAGG + Intronic
1113639993 13:111950319-111950341 CAGGTCTGACACCTTGGTGGAGG + Intergenic
1113886137 13:113659193-113659215 CGGCTCAGACGCTTTGCTGTTGG + Intergenic
1113886354 13:113660733-113660755 CATCTCTGTCACCTTGGTGTTGG - Intergenic
1115387681 14:32816562-32816584 ATGCTCAGACACTTTGGTTTAGG + Intronic
1115806285 14:37055601-37055623 CAACATAGACACCTTGGGGTAGG - Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1119043983 14:71301288-71301310 CAGATCAGACTTCTTGGTTTTGG - Intergenic
1202902209 14_GL000194v1_random:50459-50481 CAGCTCTGACTCCAGGGTGTGGG + Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1127670265 15:61188116-61188138 AAGCCCAGACAGCTTGGGGTTGG - Intronic
1128526910 15:68418774-68418796 GAGCTCAGACAGTTTGGTTTTGG + Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129110534 15:73334572-73334594 TAGCTCAGACACCAGGGGGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1130060982 15:80569794-80569816 CCACTCACACACCTTGGTGCAGG - Intronic
1130582726 15:85153022-85153044 CAACTCACACTTCTTGGTGTGGG - Intergenic
1132993726 16:2811815-2811837 AAGCTGAGACACCCTGCTGTGGG - Intergenic
1133823267 16:9255854-9255876 CAGCTCTGCCACCTTGGAATTGG + Intergenic
1134044015 16:11088353-11088375 CATTTCAGATACCCTGGTGTGGG - Intronic
1135732707 16:24907953-24907975 CAGCACAAACACCCTGGTGCCGG - Exonic
1136389164 16:29951464-29951486 CAGCTCGGACACAGTGGGGTAGG - Intronic
1137233054 16:46586137-46586159 CATCTCTGACATCTTGGTTTTGG - Intronic
1138122420 16:54411329-54411351 CAGTTCACACACCTGGGTGCAGG + Intergenic
1139449111 16:67016188-67016210 CCACTGAGACACCTTGGGGTGGG + Intergenic
1140299770 16:73745749-73745771 CAACTCTGACCCATTGGTGTTGG + Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141102779 16:81210219-81210241 CAGCCCTGACACCTTGGTGTCGG - Intergenic
1141411839 16:83840270-83840292 CAGCTCAAAGACCTGGGGGTGGG + Intergenic
1141884164 16:86880376-86880398 CAGCACAGACACCCTGGTTCTGG - Intergenic
1142326254 16:89416860-89416882 CAGCTCAGACCCTGGGGTGTGGG + Intronic
1143148160 17:4789806-4789828 CAGGTCTGTCACCTTGGTGAAGG - Exonic
1143618036 17:8064988-8065010 CGGACCTGACACCTTGGTGTGGG - Intergenic
1146946999 17:36880190-36880212 CAGCTCAGGCCCCTTGGTCCCGG + Intergenic
1150516378 17:65814291-65814313 CAGAGCAGACAGCTTGGTTTTGG - Intronic
1152022104 17:77785382-77785404 CAGCCCAGAACCCATGGTGTGGG - Intergenic
1154446557 18:14439847-14439869 CACCTCAGAGTCCTTGGTCTAGG + Intergenic
1155027669 18:21957202-21957224 CAAGTAAGACACCTTGGAGTTGG + Intergenic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157580939 18:48773794-48773816 CAGCTCAGGCAGGTTGGTATGGG - Intronic
1158220883 18:55149618-55149640 CAGCTCTGCCTCTTTGGTGTTGG + Intergenic
1158701871 18:59755411-59755433 CACCTCAGACTCCTTGGAGCTGG - Intergenic
1160240057 18:77116935-77116957 CAGCTCCGACCTGTTGGTGTTGG - Intronic
1160508925 18:79442539-79442561 AAGCCCAGACACCTTGGAGCCGG + Intronic
1160532852 18:79575704-79575726 CATCTCAGGCACCTTGGTGATGG + Intergenic
1161164453 19:2778602-2778624 CAGCTTAGACACCCTGGGCTAGG + Intronic
1162779145 19:12997556-12997578 CAGCTCAGACACCGCTGGGTAGG - Intronic
1164489176 19:28690961-28690983 CATCTCTGACATCTTGGTTTTGG - Intergenic
925422635 2:3725108-3725130 CAGCATAGACACCATGGTGCGGG - Intronic
926558794 2:14392521-14392543 CAGCTGTGAGACCTTGGTCTGGG - Intergenic
927973663 2:27322080-27322102 TAGCTCACACACCTTTGTGGGGG + Intronic
929030336 2:37644419-37644441 CATCTCTGGCACCTTGGGGTCGG + Exonic
931277689 2:60757942-60757964 CAGCTCTGACACCATGATGACGG - Intronic
931696314 2:64873344-64873366 CTGCTCAGACTTCTTGGTCTCGG - Intergenic
932224968 2:70032323-70032345 CTGCTCAGACACCTTGGCTTAGG + Intergenic
935591162 2:104846333-104846355 CTGGTCAGACACTTTGGTGGTGG - Intergenic
936049936 2:109214972-109214994 GAGCTCACACATCTTGGTGGAGG + Intronic
937432342 2:121849563-121849585 CACCTGAGCCACCGTGGTGTTGG + Intergenic
940820021 2:158342714-158342736 CAGATAAGACACCCTGGTGAAGG - Intronic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
942759520 2:179382395-179382417 CAGATCAGCCAACTGGGTGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944420739 2:199527271-199527293 CAGCTCAGACAGGTCGATGTTGG - Intergenic
945558703 2:211311342-211311364 CAGCCCAGATACATTGTTGTAGG - Intergenic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
948922578 2:241072669-241072691 CTCCTCAGACACCTTGCTGGGGG - Intronic
948947436 2:241228219-241228241 CAGCTCAGTCACCTCCGTGGCGG + Exonic
1171945717 20:31375614-31375636 CAGATCATAAACCTTGTTGTTGG + Intergenic
1173383659 20:42568690-42568712 CAGCTCAGACAGCTCTCTGTAGG - Intronic
1174522663 20:51143681-51143703 CAGGCCAGGCCCCTTGGTGTGGG + Intergenic
1174802462 20:53575840-53575862 GAGCTCAGGAACCTTGGTTTGGG + Exonic
1175420181 20:58827032-58827054 CAGCTCAGTCACCTTCATGAAGG + Intergenic
1176621577 21:9065226-9065248 CAGCTCTGACTCCAGGGTGTGGG + Intergenic
1179729454 21:43359538-43359560 CAGCCCTGACTCCTGGGTGTTGG - Intergenic
1181787427 22:25237296-25237318 CAGGGCAAACACCTTGGTTTGGG + Intergenic
1183936043 22:41262979-41263001 GAGCTCAGACGCCATGGTCTGGG - Intronic
1183986928 22:41575208-41575230 CAGCTCAGTCACCGTGGGGACGG - Exonic
1185166899 22:49266929-49266951 CAGCTCAGACACCCGGGTGCAGG + Intergenic
1185230392 22:49677268-49677290 CAGCTCAGGCTCCTTGGGGGAGG - Intergenic
949448522 3:4161788-4161810 CAGCTCAGCCACAGTGGGGTAGG - Intronic
951690405 3:25389595-25389617 CAGCGCAGAGAACTGGGTGTTGG + Intronic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
952808603 3:37381235-37381257 CATCTCTGTCATCTTGGTGTTGG + Intergenic
955398079 3:58571588-58571610 CAGCTCCCACTCCTTAGTGTGGG + Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
963828699 3:149983874-149983896 CAGCTCTGACACCTTGATTTTGG - Intronic
966121840 3:176530009-176530031 CAGCACAGACACTGTGGTGGTGG + Intergenic
967606478 3:191452560-191452582 CAGATCAGCCACCTGGGTGTTGG + Intergenic
967895973 3:194396764-194396786 CAGCTCAGAACCCTGGGTGTGGG - Exonic
968053595 3:195673735-195673757 CAGCACAGACACCCTGTTGAGGG + Intergenic
968102218 3:195974627-195974649 CAGCACAGACACCCTGTTGAGGG - Intergenic
968359368 3:198136720-198136742 CAGCACAGACACCTCGGTGTAGG - Intergenic
969726694 4:8922402-8922424 CAGATCAGCCACCTAGGTGAGGG - Intergenic
972338420 4:38129147-38129169 CAGCTGAGAAACCCTGCTGTGGG + Intronic
977359731 4:95986730-95986752 CATCTCCAACACCTTGGGGTGGG + Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
977978264 4:103292904-103292926 CAGCTCAGTAAAATTGGTGTTGG - Intergenic
980218472 4:129881998-129882020 CAGCTTAGAAACCTGGCTGTTGG - Intergenic
982296464 4:153834195-153834217 CCTCTCAGACACCTTGGGGCTGG + Intergenic
985087965 4:186333774-186333796 CATCTCTGTCACCTTGGTGTTGG + Intergenic
986548754 5:8929028-8929050 CAGCTCAGACAGCTGCATGTAGG + Intergenic
988870554 5:35384879-35384901 CAGCTCAGAAGCCATGGTGTGGG - Intergenic
989767134 5:45100847-45100869 CTGCTCAAACACCTTGCTGAAGG - Intergenic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995458317 5:112375512-112375534 CATCTCTGCCATCTTGGTGTTGG - Intronic
997472541 5:134124851-134124873 CAGCTCAGACATGGTGGAGTGGG - Intronic
998821330 5:146060285-146060307 CAGCTCAGAGATTTTAGTGTTGG + Intronic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
998940872 5:147280638-147280660 GAGCTCAGACTCCTTTGGGTGGG - Intronic
999204442 5:149837934-149837956 CAGATCAGACACCCGGGTGTGGG - Intronic
999229548 5:150053589-150053611 CAGCTCAGGCCCCTTGGAGCAGG - Exonic
999511808 5:152260035-152260057 CAGCTCAGACACCAGGCTGCTGG + Intergenic
1000494186 5:161957731-161957753 CAGCTTTAACACATTGGTGTGGG + Intergenic
1001666351 5:173436538-173436560 TATCTCAGATACCTTGGTGAAGG - Intergenic
1002192241 5:177484338-177484360 CCACTCAGAGACCTTGGAGTTGG - Intronic
1002851216 6:997968-997990 CAACTCTGATACCTTGGTTTTGG - Intergenic
1002939092 6:1700077-1700099 GAGCTCATACACTTTGGTGTCGG - Intronic
1006523086 6:34583425-34583447 CAGCTCACCCACCTGGGTGGAGG + Intergenic
1009353411 6:62709432-62709454 CAGCTCAGCCACAGTGGGGTAGG - Intergenic
1010515559 6:76769314-76769336 CAGCTCACACATCTGGGTGGGGG - Intergenic
1011810541 6:91127860-91127882 GAGTTCAGACACCTTGGTTTTGG - Intergenic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1015794546 6:136997942-136997964 CAGTTCATAAACCTTGGTGTAGG - Intergenic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1018317547 6:162571690-162571712 CAGCTCAGGCACCTTGCTCCTGG - Intronic
1019260627 7:79956-79978 CAGCACAGACACCTCGGTGTAGG + Intergenic
1019888147 7:3923572-3923594 CAGCTCAGAAACTCTGGTATGGG + Intronic
1022826336 7:34018081-34018103 CAGCTCACAGACATTGGTTTTGG - Intronic
1023223718 7:37947766-37947788 AAGCTGAGACATCTTGGTGTTGG - Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1023865786 7:44237775-44237797 CATCTCAGACACCTGGGTTGGGG + Intronic
1026396396 7:69958743-69958765 CGACTCAGACACCTTGGAGGTGG - Intronic
1026466268 7:70657670-70657692 CAGCTCAGATCCCTTAGTGAAGG - Intronic
1029259101 7:99289336-99289358 TAGCTCTGCCACCTTGGCGTTGG - Intergenic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1029665940 7:101995126-101995148 CAGCTCAGAAACCTGGCTGGGGG + Intronic
1029994319 7:104991955-104991977 CACCTCAAACATCTTTGTGTTGG - Intergenic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1031013844 7:116551138-116551160 CAGATCAGACTCTTTGGGGTGGG - Intronic
1032402418 7:131633096-131633118 CAGCTCAGACACCACGGGCTTGG + Intergenic
1034107865 7:148506328-148506350 TAGGTCAGAGACCTTGGTGAAGG - Intergenic
1035259455 7:157652448-157652470 CAGCTCTGACACCTTGCTGATGG + Intronic
1035604630 8:921698-921720 CAGCGCAGCCACCTGGGTGGAGG - Intergenic
1038878216 8:31576030-31576052 CAGCTCCTACAACTTTGTGTGGG - Intergenic
1039926220 8:41934410-41934432 CACCTCAGGCTCCTTGGTTTCGG + Exonic
1041106740 8:54452405-54452427 CATCTCAGACACATCTGTGTAGG - Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042003347 8:64152198-64152220 AAGCTCAGACATCTTTCTGTGGG + Intergenic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1043227062 8:77746154-77746176 CAGCTCAGCCACAGTGGGGTAGG + Intergenic
1045466129 8:102471276-102471298 CATCTCTGTCATCTTGGTGTTGG - Intergenic
1047097751 8:121642025-121642047 CAGCTCAGAAACTTTTGAGTTGG - Intergenic
1049931743 9:463881-463903 TCTCCCAGACACCTTGGTGTTGG + Intronic
1050243889 9:3667793-3667815 CAGCACAGGCATCTGGGTGTAGG - Intergenic
1051449668 9:17181507-17181529 CATCTCTGTCATCTTGGTGTTGG + Intronic
1054735556 9:68746584-68746606 CAGCTAACTCTCCTTGGTGTGGG - Intronic
1057351098 9:94299445-94299467 CAGCTCAGACACCAAGTTCTTGG + Intronic
1057841404 9:98488132-98488154 CCGCACTGACACCTTGATGTTGG + Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1062744055 9:138200434-138200456 CAGCACAGACACCTCGGTGTAGG - Intergenic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189328976 X:40131131-40131153 CAGGTCAGACAACCTGGTTTGGG - Intronic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1190948617 X:55120255-55120277 CAGCTCAGTGACTCTGGTGTGGG + Intronic
1192279627 X:69671307-69671329 CAGCTCAGACACCCCACTGTGGG - Intronic
1192676900 X:73206590-73206612 CAGCTGAGTCATCTTGGTGTTGG - Intergenic
1192678247 X:73223019-73223041 CAGCTCAGACCCGATGGCGTGGG - Intergenic
1192938667 X:75888998-75889020 CACCTTAGACACATTGGTTTTGG - Intergenic
1193650317 X:84123342-84123364 CAGCTCAGCCACAGTGGGGTAGG + Intronic
1194586184 X:95736842-95736864 CAGCACAGTCTCCTTGGTGGTGG + Intergenic
1195361074 X:104084462-104084484 CAGCACAGAAGCCATGGTGTGGG + Intergenic
1197339182 X:125244769-125244791 CAGTTCTGACACCTTGATCTTGG + Intergenic
1199255396 X:145713618-145713640 CAATTCACACACCTTGGGGTAGG + Intergenic
1201158101 Y:11150679-11150701 CAGCTCTGACTCCAGGGTGTGGG + Intergenic