ID: 1063718427

View in Genome Browser
Species Human (GRCh38)
Location 10:8553671-8553693
Sequence GTAAGGTCAGACTACAACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063718427_1063718429 -10 Left 1063718427 10:8553671-8553693 CCCACGTTGTAGTCTGACCTTAC No data
Right 1063718429 10:8553684-8553706 CTGACCTTACACATCCACCCTGG No data
1063718427_1063718436 18 Left 1063718427 10:8553671-8553693 CCCACGTTGTAGTCTGACCTTAC No data
Right 1063718436 10:8553712-8553734 AGGAATGGAGAAGAAGAATTCGG No data
1063718427_1063718431 -2 Left 1063718427 10:8553671-8553693 CCCACGTTGTAGTCTGACCTTAC No data
Right 1063718431 10:8553692-8553714 ACACATCCACCCTGGTGAGAAGG No data
1063718427_1063718437 19 Left 1063718427 10:8553671-8553693 CCCACGTTGTAGTCTGACCTTAC No data
Right 1063718437 10:8553713-8553735 GGAATGGAGAAGAAGAATTCGGG No data
1063718427_1063718438 22 Left 1063718427 10:8553671-8553693 CCCACGTTGTAGTCTGACCTTAC No data
Right 1063718438 10:8553716-8553738 ATGGAGAAGAAGAATTCGGGTGG No data
1063718427_1063718432 3 Left 1063718427 10:8553671-8553693 CCCACGTTGTAGTCTGACCTTAC No data
Right 1063718432 10:8553697-8553719 TCCACCCTGGTGAGAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063718427 Original CRISPR GTAAGGTCAGACTACAACGT GGG (reversed) Intergenic
No off target data available for this crispr