ID: 1063718430

View in Genome Browser
Species Human (GRCh38)
Location 10:8553688-8553710
Sequence CTCACCAGGGTGGATGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063718430_1063718438 5 Left 1063718430 10:8553688-8553710 CCTTACACATCCACCCTGGTGAG No data
Right 1063718438 10:8553716-8553738 ATGGAGAAGAAGAATTCGGGTGG No data
1063718430_1063718439 18 Left 1063718430 10:8553688-8553710 CCTTACACATCCACCCTGGTGAG No data
Right 1063718439 10:8553729-8553751 ATTCGGGTGGAATGAAGACCTGG No data
1063718430_1063718437 2 Left 1063718430 10:8553688-8553710 CCTTACACATCCACCCTGGTGAG No data
Right 1063718437 10:8553713-8553735 GGAATGGAGAAGAAGAATTCGGG No data
1063718430_1063718436 1 Left 1063718430 10:8553688-8553710 CCTTACACATCCACCCTGGTGAG No data
Right 1063718436 10:8553712-8553734 AGGAATGGAGAAGAAGAATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063718430 Original CRISPR CTCACCAGGGTGGATGTGTA AGG (reversed) Intergenic
No off target data available for this crispr