ID: 1063718434

View in Genome Browser
Species Human (GRCh38)
Location 10:8553701-8553723
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063718434_1063718438 -8 Left 1063718434 10:8553701-8553723 CCCTGGTGAGAAGGAATGGAGAA No data
Right 1063718438 10:8553716-8553738 ATGGAGAAGAAGAATTCGGGTGG No data
1063718434_1063718439 5 Left 1063718434 10:8553701-8553723 CCCTGGTGAGAAGGAATGGAGAA No data
Right 1063718439 10:8553729-8553751 ATTCGGGTGGAATGAAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063718434 Original CRISPR TTCTCCATTCCTTCTCACCA GGG (reversed) Intergenic
No off target data available for this crispr