ID: 1063718439

View in Genome Browser
Species Human (GRCh38)
Location 10:8553729-8553751
Sequence ATTCGGGTGGAATGAAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063718435_1063718439 4 Left 1063718435 10:8553702-8553724 CCTGGTGAGAAGGAATGGAGAAG No data
Right 1063718439 10:8553729-8553751 ATTCGGGTGGAATGAAGACCTGG No data
1063718433_1063718439 8 Left 1063718433 10:8553698-8553720 CCACCCTGGTGAGAAGGAATGGA No data
Right 1063718439 10:8553729-8553751 ATTCGGGTGGAATGAAGACCTGG No data
1063718430_1063718439 18 Left 1063718430 10:8553688-8553710 CCTTACACATCCACCCTGGTGAG No data
Right 1063718439 10:8553729-8553751 ATTCGGGTGGAATGAAGACCTGG No data
1063718434_1063718439 5 Left 1063718434 10:8553701-8553723 CCCTGGTGAGAAGGAATGGAGAA No data
Right 1063718439 10:8553729-8553751 ATTCGGGTGGAATGAAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063718439 Original CRISPR ATTCGGGTGGAATGAAGACC TGG Intergenic
No off target data available for this crispr