ID: 1063719554

View in Genome Browser
Species Human (GRCh38)
Location 10:8566260-8566282
Sequence GATAGAGTCAACCGTAGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063719554_1063719564 22 Left 1063719554 10:8566260-8566282 CCTCAACTACGGTTGACTCTATC No data
Right 1063719564 10:8566305-8566327 GTAACTATTCAGGTGGGCATGGG No data
1063719554_1063719560 15 Left 1063719554 10:8566260-8566282 CCTCAACTACGGTTGACTCTATC No data
Right 1063719560 10:8566298-8566320 GGCCAGTGTAACTATTCAGGTGG No data
1063719554_1063719563 21 Left 1063719554 10:8566260-8566282 CCTCAACTACGGTTGACTCTATC No data
Right 1063719563 10:8566304-8566326 TGTAACTATTCAGGTGGGCATGG No data
1063719554_1063719561 16 Left 1063719554 10:8566260-8566282 CCTCAACTACGGTTGACTCTATC No data
Right 1063719561 10:8566299-8566321 GCCAGTGTAACTATTCAGGTGGG No data
1063719554_1063719559 12 Left 1063719554 10:8566260-8566282 CCTCAACTACGGTTGACTCTATC No data
Right 1063719559 10:8566295-8566317 TACGGCCAGTGTAACTATTCAGG No data
1063719554_1063719556 -6 Left 1063719554 10:8566260-8566282 CCTCAACTACGGTTGACTCTATC No data
Right 1063719556 10:8566277-8566299 TCTATCCTCATTGGCTCCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063719554 Original CRISPR GATAGAGTCAACCGTAGTTG AGG (reversed) Intergenic
No off target data available for this crispr