ID: 1063719556

View in Genome Browser
Species Human (GRCh38)
Location 10:8566277-8566299
Sequence TCTATCCTCATTGGCTCCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063719550_1063719556 14 Left 1063719550 10:8566240-8566262 CCAAGTCCTCATGTCCATCTCCT No data
Right 1063719556 10:8566277-8566299 TCTATCCTCATTGGCTCCTACGG No data
1063719554_1063719556 -6 Left 1063719554 10:8566260-8566282 CCTCAACTACGGTTGACTCTATC No data
Right 1063719556 10:8566277-8566299 TCTATCCTCATTGGCTCCTACGG No data
1063719551_1063719556 8 Left 1063719551 10:8566246-8566268 CCTCATGTCCATCTCCTCAACTA No data
Right 1063719556 10:8566277-8566299 TCTATCCTCATTGGCTCCTACGG No data
1063719553_1063719556 0 Left 1063719553 10:8566254-8566276 CCATCTCCTCAACTACGGTTGAC No data
Right 1063719556 10:8566277-8566299 TCTATCCTCATTGGCTCCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063719556 Original CRISPR TCTATCCTCATTGGCTCCTA CGG Intergenic
No off target data available for this crispr