ID: 1063719559

View in Genome Browser
Species Human (GRCh38)
Location 10:8566295-8566317
Sequence TACGGCCAGTGTAACTATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063719553_1063719559 18 Left 1063719553 10:8566254-8566276 CCATCTCCTCAACTACGGTTGAC No data
Right 1063719559 10:8566295-8566317 TACGGCCAGTGTAACTATTCAGG No data
1063719557_1063719559 -10 Left 1063719557 10:8566282-8566304 CCTCATTGGCTCCTACGGCCAGT No data
Right 1063719559 10:8566295-8566317 TACGGCCAGTGTAACTATTCAGG No data
1063719551_1063719559 26 Left 1063719551 10:8566246-8566268 CCTCATGTCCATCTCCTCAACTA No data
Right 1063719559 10:8566295-8566317 TACGGCCAGTGTAACTATTCAGG No data
1063719554_1063719559 12 Left 1063719554 10:8566260-8566282 CCTCAACTACGGTTGACTCTATC No data
Right 1063719559 10:8566295-8566317 TACGGCCAGTGTAACTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063719559 Original CRISPR TACGGCCAGTGTAACTATTC AGG Intergenic
No off target data available for this crispr