ID: 1063719563

View in Genome Browser
Species Human (GRCh38)
Location 10:8566304-8566326
Sequence TGTAACTATTCAGGTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063719554_1063719563 21 Left 1063719554 10:8566260-8566282 CCTCAACTACGGTTGACTCTATC No data
Right 1063719563 10:8566304-8566326 TGTAACTATTCAGGTGGGCATGG No data
1063719557_1063719563 -1 Left 1063719557 10:8566282-8566304 CCTCATTGGCTCCTACGGCCAGT No data
Right 1063719563 10:8566304-8566326 TGTAACTATTCAGGTGGGCATGG No data
1063719553_1063719563 27 Left 1063719553 10:8566254-8566276 CCATCTCCTCAACTACGGTTGAC No data
Right 1063719563 10:8566304-8566326 TGTAACTATTCAGGTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063719563 Original CRISPR TGTAACTATTCAGGTGGGCA TGG Intergenic
No off target data available for this crispr