ID: 1063724129

View in Genome Browser
Species Human (GRCh38)
Location 10:8618062-8618084
Sequence TGGTTATACGTGGGTATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063724129_1063724135 11 Left 1063724129 10:8618062-8618084 CCTTTTATACCCACGTATAACCA No data
Right 1063724135 10:8618096-8618118 CCAAAGCCATCAAGATTCTTGGG No data
1063724129_1063724137 27 Left 1063724129 10:8618062-8618084 CCTTTTATACCCACGTATAACCA No data
Right 1063724137 10:8618112-8618134 TCTTGGGCCTCTCCAGTCTGTGG No data
1063724129_1063724133 10 Left 1063724129 10:8618062-8618084 CCTTTTATACCCACGTATAACCA No data
Right 1063724133 10:8618095-8618117 TCCAAAGCCATCAAGATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063724129 Original CRISPR TGGTTATACGTGGGTATAAA AGG (reversed) Intergenic
No off target data available for this crispr