ID: 1063724135

View in Genome Browser
Species Human (GRCh38)
Location 10:8618096-8618118
Sequence CCAAAGCCATCAAGATTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063724132_1063724135 -9 Left 1063724132 10:8618082-8618104 CCAATTCAAAATCTCCAAAGCCA No data
Right 1063724135 10:8618096-8618118 CCAAAGCCATCAAGATTCTTGGG No data
1063724130_1063724135 2 Left 1063724130 10:8618071-8618093 CCCACGTATAACCAATTCAAAAT No data
Right 1063724135 10:8618096-8618118 CCAAAGCCATCAAGATTCTTGGG No data
1063724127_1063724135 28 Left 1063724127 10:8618045-8618067 CCTGCAGGATTCTCCATCCTTTT No data
Right 1063724135 10:8618096-8618118 CCAAAGCCATCAAGATTCTTGGG No data
1063724131_1063724135 1 Left 1063724131 10:8618072-8618094 CCACGTATAACCAATTCAAAATC No data
Right 1063724135 10:8618096-8618118 CCAAAGCCATCAAGATTCTTGGG No data
1063724129_1063724135 11 Left 1063724129 10:8618062-8618084 CCTTTTATACCCACGTATAACCA No data
Right 1063724135 10:8618096-8618118 CCAAAGCCATCAAGATTCTTGGG No data
1063724128_1063724135 15 Left 1063724128 10:8618058-8618080 CCATCCTTTTATACCCACGTATA No data
Right 1063724135 10:8618096-8618118 CCAAAGCCATCAAGATTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063724135 Original CRISPR CCAAAGCCATCAAGATTCTT GGG Intergenic
No off target data available for this crispr