ID: 1063724137

View in Genome Browser
Species Human (GRCh38)
Location 10:8618112-8618134
Sequence TCTTGGGCCTCTCCAGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063724130_1063724137 18 Left 1063724130 10:8618071-8618093 CCCACGTATAACCAATTCAAAAT No data
Right 1063724137 10:8618112-8618134 TCTTGGGCCTCTCCAGTCTGTGG No data
1063724134_1063724137 -7 Left 1063724134 10:8618096-8618118 CCAAAGCCATCAAGATTCTTGGG No data
Right 1063724137 10:8618112-8618134 TCTTGGGCCTCTCCAGTCTGTGG No data
1063724131_1063724137 17 Left 1063724131 10:8618072-8618094 CCACGTATAACCAATTCAAAATC No data
Right 1063724137 10:8618112-8618134 TCTTGGGCCTCTCCAGTCTGTGG No data
1063724129_1063724137 27 Left 1063724129 10:8618062-8618084 CCTTTTATACCCACGTATAACCA No data
Right 1063724137 10:8618112-8618134 TCTTGGGCCTCTCCAGTCTGTGG No data
1063724132_1063724137 7 Left 1063724132 10:8618082-8618104 CCAATTCAAAATCTCCAAAGCCA No data
Right 1063724137 10:8618112-8618134 TCTTGGGCCTCTCCAGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063724137 Original CRISPR TCTTGGGCCTCTCCAGTCTG TGG Intergenic
No off target data available for this crispr