ID: 1063725757

View in Genome Browser
Species Human (GRCh38)
Location 10:8635675-8635697
Sequence TATCCCACCCCAATAGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063725757_1063725760 -4 Left 1063725757 10:8635675-8635697 CCGCCTCCTATTGGGGTGGGATA No data
Right 1063725760 10:8635694-8635716 GATACACTTATATATCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063725757 Original CRISPR TATCCCACCCCAATAGGAGG CGG (reversed) Intergenic
No off target data available for this crispr